Description :
From Genome Similarity Track
Location :
scaffold_321:14321- 16202
Transcript NameFunction/comments
Pl_106141hypothetical protein PHYSODRAFT_362634

Sequence
1881 bases(100 bases per row)
CTACACGTATGTGGGCCACATTCTCATTGCCATTAACCCATACCAGCAACTCGACGTCTATAGTGAACGCAAGATGACCGAGTATTATGGCAAAGCCATG
GGAATGTTGCCTCCTCATGTCTTTGCATTGGCAGATCACGCCTACACGCAACTTATTCAAGGTGGTGCATTAGATCCAGCTAATCAGAGCATTATTATCA
GTGGAGAGAGTGGATCTGGCAAGACGGAGACGACCAAGATCATTATGCAATATTTAGCTCGTGCTACGAGCTACAGGAAGGAAGAAGGCTCGGTAGTGGA
CACTACCATGTCTGGAGCTCTGGGGAAATTGGAAGAGAGAGTGCTGGAGAGTAATCCATTGCTCGAGTCTTTTGGCAATGCGAAAACATTGCGAAACGAC
AATTCCAGTCGGTTTGGAAAGTTTATTGAGATCCAATTTAACCATCATGGGAAAATTGTGGGAGCGCAGATTCTCAACTTTTTGCTCGAGAAGACTCGCA
TTGTATCGCAAAGTTTGGGAGAGAGGAACTATCATATCTTTTATCAATTGTTGGCTGGAGCGGACAATGCATTGAGAGAGCGACTGCAATTGAAGACGCC
ACATGATTATGAGTATTTAAGGAAGAGTGAGTGCTTTAATATTCATTCGTGTGATGACGCCAAGGAGTTTGCAACGACCAAGCGATGTATGGAGACCATT
GGCATTACGGAAGATCGACAAGAGATGGTGTTTGAACTGCTTGCTGCTGTGTTGCAGCTTGGCAACTTGCAGTTTGCAATGGAGAATGATACATGTGTGA
CAGTGGGTGATAACTCAGCGAATGGTATGAAACTCGTGGCGTCGTTGCTCAAAGTCAGTGAAGATGCTCTGTCCAAGGCACTGCTCACGCGTCAACTTTA
TGTGGGTGGCAAGGTCATTGTGCAGCAGCAGAACTCGGAGCAAGTGCGCGACAAGCGCGATGCACTCGCAAAGGGCATTTACTCGTCGCTGTTCTTGTGG
CTTGTGTCTGAGCTGAACCGCACGATCTCGCGTAATCAGGACAAATGGGGCTTCATCGGTGTGCTGGATATCTATGGCTTTGAGAAGTTCGAGTGGAATA
CGTTTGAGCAGCTGTGCATTAACTACGCTAACGAGAAGCTTCAAAGGCACTTCAATCAGCACATGTTAGAGGTAGAACAGAACGACTACGCCAAGGAGGG
GATTGACTGGAAGCACATCGACTTTGAGGATAACCAAGAGTGTCTGGACCTGATTGAGAGCAAGGTGAACGGTAAGCCGGGTATCTTTGTTTCACTGGAT
GACAACTGGCGACTCAAGGGTGAAGAAGCGAACAAGAAGTTTGTGTCCAACCTGCACAACTCTTTTGGTCGCACCTCGAGTGGCCATTCGAGCAGCAAGA
ACAGATTCTACGTCCACCCGAAAATGGACGCAGACTTGCACTTTGGTATTAAGCATTACGCCGGCGAGGTGATTTACGACGCAAGCGGCTTCAACGACAA
AAACAACGAGACGTTGAACGACGACATGAAGGAGCTTATTCGGCAATCCAAGAGCGACTGGCTGCGCGGAATCTTTGATCTTAACATGCAGTCGATTGAA
GCTATCCCAGGCAACAAGCCGCAGCAGCAGCACTCAATCTCTCGGCGCCCGAACGAGATGAAAAAGGGTCAACAAGGAGGCAAGTCACGTAACATTCGAG
AAGTGTCTGTAAGTGCGCAATTCCGGTATCAACTACAGGAGCTCATGAACAAGATTTCGCTTGCGAATCCTCGGTATGTGCGTTGCATTAAGCCGAACGA
GTTCAAGCGTCCAAGCGAGCTCAATGATATGGACTGTGCGCGGCAGCTGAAGTACTCGGGAATGATGGAGGCAATTCAGAT