Description :
From Genome Similarity Track
Location :
contig_94:14320- 18894
Transcript NameFunction/comments
g10805.t1hypothetical protein

Sequence
4574 bases(100 bases per row)
CTTCTCCATCAGCACCAGCAGTCGTCGCGGGGACGTTTACCTGGATACTCTCGCCGCTACCCGAAAACAGCGGCAATCACGATTCGGTGCTCGCTGGAAG
TTCTTTCTTCGGACGATCTTGCGTGGACTGGTCGAGGGTCGGTGTGATTTGGACATTCTGCTCGATCCTTTCTTCATGCACCGACCTCGGCCGGGTGAGG
AGAAGATGTGGTATCCAGGGCAGCATGGCAACTCGCAGGCGACGAATCTGATCACCGCAGTCCAAGAGGCGGACTTGGCTGAGCCCTGGCGAGTCCAATA
CCGCCACGACATCCGATCGCATCCCGCGCAACGCATTGCGCGTCTTCGTAGCAAATTCGTCATCCCAGCTTCCCCTTAAGCGTACACTTGAGTGTTAGTC
TGCATGTAATTCCATTTTCACCTCTTTTTCTCCAGTTGTCTTCCTTGATCGGGTCGATCGAACCTCGTAATCGGTTCTCTCCCCTTCACGCCACTTTTTT
TGTACATATACCTCCTCCTTCTTTCTGAGTGCAGCCGCCCTGCACCCAATTCACTCTCAACTCGCAGCGATCGCCACGAGTTGCCCTCCTTCTTCCTAAG
TGCAGCCACCCTGCACCCATTTCACTCCCAACTCGCAGCGATCACTACGAGTTGTCCTCCTCCGCCTCGTGCGATTGCATCACTCCGAAGCGATTCCGTC
TAGTGCGCTCGCGCTCAAACTCGTGCATCAAAGCCCCGCAGTTGAGGTCAGCCTCGTCGACCCAAGACGGTTCGGTGTATCCCTTCCAGAAGACCTGGAA
TTCCCGATGGACGCGTCCATATCTGGTCTTACGGCCCGATCGGACATCTGTGATCCGCTCCACTTCAAACTCGTCATCACTCCGATCACCTTCCCAGCTG
TCCTCCGGCAACAACGCCTCATCAAAATCAAATCGACCATCCTCGTCCGTTGCTAGCGTCACGTCAGGACGATCAGAGAAAACCTTCACGGCCTTGAGCT
TCGAACGTGTACAATTGGAAAAAGACGATACTCGGTGCCGGCCACCTCTAGCCGGGCCGCGTAGGGGCCAATCATCTCGCGCACCCGGAACGGTCCGTGC
CACATGTGTGCCAGCTTTCGGGCATAGCCCTCCTTAACTCGATCCAAATATAGCCACACTTGTGACCCGGCCTCAATCTGGTGCGGCCTTATCCCGTCGT
TGTGGCGATCGGCTCTCGTTTGGATCGCCTCCTTCAGGCGCGCGTTGACCTCCTCGCGAGCTCGCTGGTACTGTTGCTGGATACGATATCTCCATCTGCG
CGGCTCGCGATCGCGACGTCGCGTGCTGCCTAACGGTAGCGACGCTTCCAAGGTCGATCGTGGGTCCCAGCCATGGACAAGGTAAAACGGCGTCTCTCCT
CGTACTCGATCGTGAGCAGTGTTGATCGCGAAAGTCAGGCGTTCCGCGTATTCGTCCCAGTCTTGTTGATTCACATCGGCGACATACATCTTCAAAGCGC
GAGTAAGCGTTTGCACCATCCGCTCAGCGGTACCGTTTGCCTGTGGTCGATAGGCCATGGTGGCTCGTTGTCGTTGTCCCACTATACGGCTGAATGCGCG
GAAGAAATCAGACATAAAACCGGGCTCCCGATCATGTCGGATCGCTTCACTGGCTCCGAAGCGGCGGAAAACGCATTCCTCGTAGTTCTCCGCGATGGTC
TGCGCTGTCCGAGACGCGCCGGCCTTAGCGATCACGTACCCTGAGAACAGATCGACCCACACAAGAAGCTCCGTGTTGCCCTTGAACGATTTTGGCAGAG
ATGGGATGTGGTCCATCGCGATGATTTGGAAGGGGTAGGTGGCCCGTACATTCCCAGGTGATTCTCCTTGAACCACGGGGCGCCCCTTCCCTGTCTCGCA
ATCCACGCATTCACCCACAAACTGCTGGACACTCTTGAACAGCCCCGCCAGTGAAGTGCGCTTTGATCCGTTGGTACGTCCTCCCGATTCCCTGGTGCCC
TCCTTCAAGGCTGGCGTGATAATGGTGAAGGAAATCTTGGTGCAACGTTGCAGGTACCACCAGACGCGCGATCGAATCTCGGTCCTCGTCTAATCGGGTG
TGTTACACAGTAGAACAGCAGGCCGTCTTCCCCCACTTCGTAATCTCCAGCGATCTTGGCGCACGCTTTTGCATCTCGGGTAGTCAAGGCTGCTACGTCG
CCCCGTAGGTACGACTTCAGGTCCACATCCAGCTTGTACTAACCTCTCACTCCTCATGCGTTGGACGATCTCTTCTTGCATAGCTGCCGGCACTTGACGG
TGCCGTCGGGCTGATCGGGTCACTGCTGATACTTGAACGACGGGGTCGTCATTACTCGGGTGGAGCAACTCGCCCAGGCGGTTGATCGTGACGAGATCGC
CAATTTCGCCCTCATCAGTTACGATCACGCCTGCTTCTCGTTGCAGTGCGCACTTGCCAACCGATCGGCGCTCTGATTCCAATCGCGCTTCACATGGAGG
AATTCGTGCTTCGGCCAGGCTTTCACTTGTCCATCGCTTTCTGACGTAGTATCTGGAGACCCGGTGCCTTGCAATCGATTTCACCACGCATCTGTCGGAT
GATCAGTTGGAATCTCCACAGATCACAACTCGCCCCTGTTCTGATCGGACAGTAACTTGAAGCCTAGCAGCAGTCCGCGATATTCGGCTTCGTTGACAGT
CAGATCGTCGGCGAATTCGGATGCGGCAGATATGATCGACCACTCCGGGAGCTTCCAAACAATTGCACTATACGCTCCGGCGCTCCGCTTGACGCGTGCT
GACCCATCAAAACTGACGACGAGCACTCTTCATCCAGCTCTACCGTCGGCGGGGCCATCACGATCGTTCGTTTGGGCTCTTTCACCGGTGCAATCGCGAT
CAAGGCCTCGTCCACTTCCGCTCGGGGTGTAATGCTGGCGGCGATCGCGCCCAGGATTTCGTCCTCTCCTTTCAAGCACTTCCGGATTTCCAAGGTCCAC
TCGGACAGCAGAGCTGCCCATCGTCCCAATCGTCCCTGGAAGCCCGACATTCAGCAACCAGGCGAGCGTCGAATACCTCGACAGCACCTTGATCGATCGG
TTGGTCAGGAGTGTGTAACACATCCAAGATCCGGAGGAGCGCCAAAACTTCCTTGTCCACTATGCCGTAATTCAATTCGTTCGACTTCAGCGTACGACTG
GTGAAGATCACAGGCCAATACATGCCATCATGTTCCTGAACCAACGCAGCTGAAATAGCCCACTTGTTGGCGTAGACCACGATCACAGGCTGGCGATCGG
AATCGAAGTGTCGCAAAATCGGGGTGGTCGCAAGCTTGGCCTTCAGTAGGTCGAACGCCGTCCTCGCTCTAGTCCACCGATCGTCGGACTCCTGCTCGGT
CCTCATGCTTCCCGTGGTGCATCTCGTAGAAGTCCACTTCTCGCAGTTCGTATAAGATCGGCGTAAACGGCGAAGTCTTCAATGAAGCGACTGTAATAAT
TCAGGCTTCCTAAGAAGGACTGCATCGATCGCAACGTCTTCGGAAACGGCAGCTTCTCCAGCGATTCCAGATCTTTCGGATTGGCTTCCAAACCATCGGC
CGATACCCGATGACCCAAGTACTCTACCTTCCGATGTCCCCAGAAACTCTTGACCACGCTGATCGACAGGTTCCATCGCTCGCAAGCGTCAAGCAGTGCC
TCGACCTTCTCGCAGATCGAGTCCCAGGTGTCAGCGGTGATCAGGATATCGTCGATGTACGATCGCCTGCCCAGCACCGAAGGTCCCGGGTTTGCCTCGG
GTTCCCCTTTCTCGAACACGTCGGTTGGTTCCGTGTGGTCTCGATCAGGGCTTATCCGGAGGTATCCGTACAGAGCATTATCGATCAGCCTCTGGTAGAT
TTGTGGGGCGTTCTTCAGCCCGAAGGGCATACGCGTCCACTCGAAGAGTCCGAAAGGCGTAACGAACGCGGAGATCTTCGTGCACGTTCCGTCATGGAGA
CCACCCAAAACCACTAGCCATATCCAAAGAGCAGTACCAGAGTACTTTGTCCAAGTCCTCCAAGAGATCGTTGATCAGCGGCATGGGATATACCATCAAC
CTGGTCAGGCTATTCACCAAACGGTAGTCGATGCACAGCCGGATGTCGACTCCATTCTTCTTGATGATGATCACGATGGGGATGCCCATGGTGAGGTTGA
TGGCTCAATCATTTTCGCGGACAACAAACTCTTGATCAGATCAGACAGTTTCTCTCGGAATTGAGGGGCCACCCTCCGCACGCGTTGGGCGATGGGAGCG
GCTCCTCCAACGTCGATGTCGCACACCGCACCAATCGCAGCGGGTGGAAGGGCGTTCCCTTTACCGATCAGCAAGTGTCGTCGCCGCCAGATGATCTGGC
GAAGTCGATCGATCTCCTCAGGTGTATTCGTTTCCGGATCACCTACTTGAATGTCTTCGATCGTGACTTCGTCGGTAGTGATCGGCACTTCGGGTAGGAT
AGCCATCTGGCTTTCCACGTCTTCCGCAAACAAGGCACCACCTTCATGGAAACACACCTCTTCGTCTTCTGGAG