Description :
From Genome Similarity Track
Location :
Scaffold_1505:1432- 3778
Sequence
2346 bases(100 bases per row)
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGCTGCCGCTGCTTCTCGTCCCATATCGCAACAGCCTTCGGGCAGTCTGCCTGGAGCTGCTCAACGAGCTCCCACGAGTTATCCGAC
TCAGGGTAACCCCTCCACTTCACGAGCAGCTGGCGCTTGCCATGGAGCCGCCGCTCCCGGACGACTCGTTCCACGTGGTAGTGGATCTGCCCATTACGAT
CAAGGAGGGCCGGCGGTGGCCTCGCACGGCCATGGCTACGAGCCTGAGGCGACGCAGCCGTATGCTGGGGCCCCGAGTCAGGTGGTGGCCCTGCAGCAAG
AGGAGATTCGTCTTCTCCGGGACCGTGTGTACGTCCTCGAGATCGCGCTTGGCGTCGGCCTTGGTGGCGAGGCTGCCGCTCGTGCTGGTCAGCCTGGTGC
CGTGGAGCGGCTCCGTGAGGATGTTGCCTCGCTCTATCAAGAAACTCGCAGTCTCCATGGCCGTGTGGATCGTCGAGCCGACCTGTCGTCTTACGACTCG
CTGCGAAACCAGCTCGCTGGCCTTCGGGCCGAGCTTCATGGCCACGCGCCGTATCCGGAGCAGCAGCCCCACTCGTATCAGGCCCAGTTTGGCCAGGGCT
CGTACGGGGCCCCTGCGTATGCTGATCCGATGTACGCCGCGCCGTCTTACGACCAGCGCGCGTATCAGGCGCCTTACCGCGACCCGACGCCGCGCTTCGA
GGAGCTGCGCTCTTCTCCACCGGGCCACCCACCGCTTCCTGCGGGGCAGCCAGAGCCAGAGGGTCATGGTACCTCTTAAGACGACCCACGTAAAACGTCG
GGTGAGTCGTCATCGACTTGGGCAAGTCTATGGTGTACGCCGCGCCATGCTGGCTGAGGACCGTGAAGGGTCCAATGAAGCGGTGCTTCAGCTTGTTGCT
CTCGACCGAGCTAACAGTGTTTAGCGGTAGGTTTCTAGTATCTAGGAGAACTAAATCCCCAACCTTAAACACGTTCATGTTTCCTCTTCCATTTCGGTCA
GAGTACTCCTTCTGTTTATCTTGGGCTTGCGCCATGGTGTCTCGCACCCTGCTGAGTATGTTCAGCCTGTCTTCGGCAAACGAGGACAGTTGCTTCCGCA
AGGCGGCTGGACTCACGTCCGAGACTTGGGAGAAAAAGGTTTTCCGAGCCTCTCCCCCACTTAGGACCGAAGCCCCGGTACTGCCTCGTAATGTGAGCGG
CACCTGAGGGTGGCGCAACCCGTTCAGGTAAAAGGGCGTAAAGCCCGTCGATGCATGTACCGCATTGTTGAGTGCGAACTCAACCATGGGCAAGCGATCA
GCCCAAGAGCGGGGCATCTCCGCGCAGATACTGCGGAGCGTGTCCTCGAGCACGCGATTGACGCGCTCCGTCTGGCCATCCGTCTGCGGGTGGTCCGCCG
TCGACATCGACAGCCGTGTGCCGGGAAGGCGAAACAGCGTCTGCCAGAACGTAGCGGTGAACCGCGGGTCTCGATCAGAGACAATGGTCTCGGTCAGACC
GTGCTGTCGGAAGACACAGTCCATGAACAGGCGAGCGACCTCGTCGCCAGTGACGGTGTCACAAACTGGAGCAAAGTGGACCATCTTGCTCAGACGGCAC
ACGAAGGCAACAACACCAGTGTTGCCACCGTCATCGGCCGGAAGTCCGAAGACGAAGTCGAGACTCATCGACTTCCAGCAGCCCGCTGGGACCGGCAGGC
TCTGCAATGGTGCCGAGGCGTGACCGGCAGGCTTCACGCGCTGGCACGTCTCGCACGTACGGACGTAGGTGGCGACCCACTTGTACATGTGACGCCACCA
AAACATCTGCGAGACAGACGCGTACGTCTTCTCACGGCCGAGATGG