Description :
From Genome Similarity Track
Location :
Scaffold_1747:1432- 2811
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1747-fgenesh-gene-0.0Dicarboxylate/amino acid:cation

Sequence
1379 bases(100 bases per row)
CGGGCTGCTGCTCGCGAAGTACGAAGTGGACGGCGACTACGCGAAATGGATCAAACTGCCTGGCGACCTCTTCGTCGACGCGCTCAAGTGCCTCATCGTA
CCCATGGTGTTCTGTAGTGTCGTCGTGTGCATCGGCGAGCTCGTGGAGGCCGGCAAGGCCGCGAAGATTGGCGGCCGTATCATCCTGTTCTTCACGATGG
CGTCCATTATGTCGTCGACGCTCGGGACGATCTTCGGCTGGCTCTTCAAGGGCGTGTTCAAGGCGCAGATGGTCGCGGATGACGGCCATAAGACCCCGAA
ACTCTGGTTCCGATGCGCCGAGGGCCTGTTCTTGTCGATGGCCCGCAACGGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCCGGGGTCGCAGCCGT
GGGCATGAACGAAACGAGCCTAGACCCAAACCTGCTGTTCACGCTCAACGACACCACGGGCTTCTTCCAGTCGTCGACCGACGAGTTCCAACAGCTGAGT
GTCTCGGAGCAGATCTTCTCGATCCTGTCGAGCATCGTGCCGGAGAATATCGTCGGATCCTTTGCCGGCACGTCGACGCTGAGCGTGATCACGTTCGCGA
TCTGGTTCGGCGTAGCGTGCGTGCGCTCGCTCGGCCGCGCGTCGCAGTCCGAGAACTACATCCTGCTGCTCGTGCTGCAGGCCAACATCGTCGCGCGTAC
GATGATCAACGCCGTGGTCAAGTTCATCCCGTTCGCGATCGTGTCCATGGTCGCTGGCTCGCTCGCGCAGTTCAGCTCATCCATCGACTTGCTTGAAGGT
GTTGGGTTTCTCATCGTGAGCCTCTTCGCCGCGCTGCTCACCAACACGATCGGCGTCATGGGCACGGCGCTCTTCCTCACCACGCGCCGCAACATCTTCT
CGTATCTGCGCAACATCATCCCGGCGCAGATCTTCATCATCGGCTGTGCGTCGTCCATGGCGACGCTGCCGCTGACCATGCGCTGCGTGGACGCCACGCG
CGAAGTGTCGTACTCACTCTCGCGGTTCGTGCTCCCACTCGGCGCCACGAGCAACCTGAACGGCACGGCCGTGTACATGCCGCTGGCGTGCATTTTCATG
GCCAAGGTTGCCGGCTACGAAGAGCTACTCACCCCTGTGCGGTACGTGCTACTCGGGTTCACCGGCGCGATCGCGTCGTTCGGCGTTGCTGCTGTGCCAC
ACTCGGGGCTTGTGATGGTCATCACCGTGTGGCGCACCGTCTTCGGCATGGACGTGCCCACGACCGTCTTCCCGCTGCTCGTCGGCACGGACTGGATCCT
CGACCGCATGCGCTCGGTCGTCAACATCACGAACGACACGATCATCGTGCGCATCATCGCCGACCAGTGCGACGAAGCC