Description :
From Genome Similarity Track
Location :
Scaffold_452:14315- 16255
Transcript NameFunction/comments
Phypl_g8476conserved hypothetical protein

Sequence
1940 bases(100 bases per row)
CTACAACCTCCGCTCGAGGCTGTGGTCAGAACCGGGTCTGGCAGCTAGGCACACGACTGAGCCGCTGACAgcgacgctgaagacgtcAAGCAATATCGGT
CCGACTTCACCTCCTGAAACGCATCACATCCCTTCGCCATTTCTTTTCACAGGTATTCTTGTCAATTAGGTTGTACCTTGGTAGTACAGATACGCGGAGG
AACCTATAATACCGGAGCTCCTGGGCCACACAAGCGGCCCGCTCCTGCCCGTGCATCGCGTCCCCAGCGTCATCCGAAGCGCGTCCACTGCTCGCACCCA
TGCGCGCGCCTAACGGGTCCTACTTGAATCGCTtgcggtggctgctggagttcCAGGCCCCGGGCATTCTGGTGCTGCATCCGTGGGGGCTCTTGGCCGC
TTTATTGCGATCCCCCAGTCGCCTATTGGACGGCGTGACGGCCTCGCACCACCGCTACTTGgaccgagctgcagccgcagtgACGCAGAACCCGGTGCTG
TTCCCCAACGGGTTTTTCTCCGATGGCTGGGGGGACTTGAATACCCCGAAACGGATTCgggaactgctgcagagccGACGCATGAGCGACGtcttgacgc
tgcaggacggAGAACCGAATTGGGGCAACGTTCGGCAGCTTTCGGTGGCCAAGGTCGCGTTAAGAGAGGGGCGGTTTAGAAGTACGTTGGGCAATgcgca
gcagttgctgccTGAGGAGAGTCTGGACGCGTTCTGTGAACTGGTCACGCCGCTGGGGTGGGAACGAGAGGGTGGGGGAATGCCACAGGGGAGGAAGGAT
CGGCCTCTTGTGGGTACGTGTGTCTGTAGCATGCTGCTAAAAGCGAAGATGTGGCGAGTAAACCGTGCGGTATGAcgtagtgctgctgccgggaACGGGG
GAGCACGGGTTTCTGCATCGGAGGACGTCCATTGCCATCCCACTGGCGAAGCAAGGAGTTGCCACATTGGTACGTTGTTTGTGAAACTTCTACTGCATTG
AGCATTTGGAGTCCTTGACCATTCCGTACGTATATATTCCTGTTGGTGCAGATTCTGGAAGGACCTTTCTACGGAAAGCGCAAACCACCTCAGCAAAAAG
GATCCAAGCTCCGAAGGTATGGCCTGACAAATTATTCCATTGGcattgtacatgtatgccGGGTATTCAATAGTGTTGTGTGTCATAGGGTAAGCGATTT
GCCGATCCTAGGGCAAGCAACAatcgaggaggccaagtcACTATTGGAGCACTTCCGCGATTGCCATGGCTTTTCGCAGCTGGTGGTCGCAGGTAGCAGC
ATGGGCGGCCTGCATGCTGCTATGGTTGCGTCAGTGTTTCCTGGAGATGTGGGTGCTACGGCCTGGCTCGCGCCACCCTCTGCCGTACCCGTGTTTGCCG
ATGGATTACTGTCAGGGTCCTGCAACTGGCGTTCGCTGTACAAGCGGCACGAGCTTCAGATGCTGGACAAAATGCTCGCTGGGCGCGCTGTAGCCGAATC
GTACGAAAAACTGGCGGATGCCCTAGCTGACGTGGAGAaagagcgagctgaagcttcCGAAGATGAGCTTGACCCAGTCCAGgaagccaagaagcgcatg
aGGTTATTCCTCTCGATTACAGACATCGATAATTTTATGCCTCCCCGACGATCGGATGCCGTGGTTTTCGTCTACGGTACTGAAGATGAGTACATTGGCT
TCGCGGAGCCCCAGTGGCAGGTACGTTTCTCTGCGTTTAGACGTGTATTTGGGCGTAAAGTATCTTACTTTCGCATTCTGTCTCGTTTTATCTTCCTTTT
AGCGCATGCGTGAACAGTGGAGGCCGGCTCATTTTAGGACGATCAAGACTGGCCACGTCACCGGGATTTTGCTGGAGCAAGAAGCCTACCGCAAGACGAT
TTTGGAGGTTGTCGATCTCTTGAAGGAGCGACGTGTAGTT