Description :
From Genome Similarity Track
Location :
Scaffold_100:14312- 15921
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_12405importin alpha-2 subunit

Sequence
1609 bases(100 bases per row)
TGACCAAAGTTGAACATGGGAGCGTTGGAAGCATCAGTGCCGAACATAAACTGGTCGTTCTGCACAGCGGGCGCGGCCATGTCGCTCTCAACCTCTTCGC
CTTGGAAGAAGCGCTCGATGATCGTCATCGACTTGTTGTAAATGTCTACATTGGCATGTTGCACCGGGTTCGACGATATATCACGATGCATACCTTCGCT
CTCGCTGTACTGGAGCATCTGGATCTTCTCAACACCGTCACACTCGTCGACGAGGTTGGAGAAGGCATTCACAAACGTCTGGTTGGCTTGGCCTTCCTCT
TCACCAACGCGCAAAATGTTCTCGAGACCTTCGAGTGCGACCGTAATGACCTTGGCGTCGTGCAAGTCAAGAAGACTGCAAAGAGCGCCGATACAGCCTA
TGGGAGTCCGTCACATTCATGATATATAATGATGGCGCACCAAAGAAGACCAATTGCTTGATCTGGAGCGGACTGCCACCAGAAGTTGCGTTCGAGATGG
CCCATGCCGCTTCCTTGCGAATGTCGAACTCCGTCTAGGATGACGCGTCAACAGATCATTGAGCAATGACTGTGGCTGTACCGAGGCTCCAAGATACTGG
ATGAGCACGGGGAAGATATCAGCGTCCATAATGTTCTGGATCTGCTGGGTGTTGCCGGCCGTAATGTTTGAGATCGTCCAGCACGCTTCCTTGCGGATAC
CTTTCTTCGGCGACTCGAGCAGTGCGCGCAGGCACGGCAAGACGTTCAAGTTGATCATGACCTGCGTCTGGATATCGTTGCCCGTTACAATGTTACCGAC
CGTGCGCAGCGCCGGAGTTTGAACCGACGGCGAGCGGTGCATGAGCAGCTCGACAATACGGCGACAGACGCCTGCCTCGATGACCGCCTGGATTTGCGGG
TTCTCGCCGTCCGAAAGGTAGCTAAGCGCCCAGCACGCATCCGTTAGAACTTCGTCGTCTTGCGTCAAAATGAGCTGGGCCAGCGTCTGCAACGCTGGGC
GCACGCTACAATTGATGGATAAGTTGCAGCAATTCGAGAGGAAAGGTCGCACTCATCAAAACGCGGTTTGGGCTTGCCGCGGCAAAAGTTGGAAAGCGTC
CACGTCGCGTTCCGCAGCATCGTCGTCTTGGAGTTCATCGTTAGCTGCTGCATGAGTGGCCGCAGTGCGTTGCAGCTCAGGACGATGTCGCGGCATTGCG
CAGAGTCGCCAGCAATGTTGCCGAGCGCCCAAACAGCCTGTTCGCGCACGTCGTCGTTCGGCGAGAGGAGCAATTGACAGAAGATGGGCACGGCGCCGCT
GCTAATGACCGTGCGGGTGTGGTCCGACGTACCAGAGGCGATGTTGGTGAGCGCCCAAGCTGCCTCGAACTGCAAACTTGGGTAGTCCTCGCGCTTCAAG
AGCTCGACAAAGACTGGCACGACCCCGAGCTTGATGACTTCCTCGATCGGAGGGTTCTTCTCTACAGCACAAGTAAGACCATTTTCGACAGCAGTACTTC
ACATCACCAATCGAAAGGAGTTTGCGGAACTTGCTCACAGACGCGAGCTGGACCTCCGAGTCGGGACTCTGCAGGTTCATGCACAGCTGCGGCAACTCGG
CAAGCTACA