Description :
From Genome Similarity Track
Location :
Scaffold_5:143098- 148372
Transcript NameFunction/comments
Phyta_totarag400glutamate-rich WD repeat-containing protein

Sequence
5274 bases(100 bases per row)
AAGGTTTTCTCGACTTGCCCACAAAGTAATAACTGCTCGTTCGTGCTGTAGTTGCTGTGGCCAATACGGCGTCCTCTCTAACGTAGATTAGCGCATACAA
ATCGCTGTTAGCCAGGGACAATCACCAGAAAAAAGCCATAGCACGATACTTCAATCGCTTACCCCAACCTTGACGTCTCGCAGCCGCCAGAGGATCGAAG
AATGAGGTTGAGCTCACTGCATGACCAAGCAAGGGATAAAGGGTCAATTACTAGGGGTTTTGTGTTAGCTCACCGTGTGACCCTAACAAGTGGGAAAGGA
TCAAATGACTATTAGCTCACTGTGTGACCCAAACAAGTGAAAATACTATGATCTTTGAATTAGCTCACTGTGACCCAAACAAGTTAGAAAGGGTCAAAGT
ACTAGGAGTCTGTATTAGCAAAGGTAAATGGAGCACGTTGAAGATAAGCTATCACATCACTTATAGACATTGCCCAATATGACTACCTGCACCCCGCCGT
GTTGAATCCGCCTACGACAGCCACCTTCTTGCGCACCGCCAACGTCCGCGCCGCCGTTGATGCGTTCAGCCGCCACGCTCGCGCACATGCTCCTCTTCCG
TGTCACGGGCATTGTTCTCCCCGGGCAGGATATTCGACAGGTGTTGGATGTATTTGTGTTGATAGCCCCACCAGTCACATCGACAGATAAAACATAGTTT
ATCACCGTACGAGATGGTAACTTGCTCGCCAGATAAGATGTCacggacggcgacggcgataACGGTGACTTCTATTCCAGTCTGCACCTCGTGAAACCTT
GCACATGGGTTGCACGAGCGGTTCATCAATCGGAGTAGgccaccagcatcaagcgcATCGATGCTGACGTGTATCCTCTCCCCCGACAGAGTCTTCAGGT
GCATCCGGTATCCCTCATTGCGGGCAGCGTTCTTGCACGGCGGACTAAAGATATCCATGTGACCGAGATACCCGCAAATGACTTCACCAGCTGGAATGGG
CCCTTTGGTCATTAAGTTACGCATACCCGTCCTCAAACTCTTGCAATGACGAGCTCCTTACTTGCTTGCAAGGCGTTGCCGGACATCCCTCCGAAAGAGC
AATTATTCTGGGTGCAGAAACGACTGTTTTTGGCATTGGCGCACGTTTGAGCATTGCAACGACTTTTGCAGTCACAGCCCTCATTTCCAGAGCTCACCGA
TGGGAAACGAAAGCGATGCTGATCATCTTGAGAATTCATCCGCTCGACGTAACACGGCCATGTGGCAGGCCTACATTCTTCGTGAGGCACGGTAGAGGGC
TTAACCCTCGACGATCTTGAAACCAAGTGAACTGGCGAGGGAGGTAGAGTGGCGGCTTAACAATTGACTGACGATAGGGACTGAACCAGCGTCCGAATCG
TCGGACATGAAGGCCTCGTAATACCACGATAAGGCGTCGAACCGACTGCACACTCGTCCCACCACGCTTTGGAGATCGCATGAGGCTCGGCGTCCACGGC
GCAACGGTGGTCGCTTGACAACGTCTTGGGCATGGCGACCACCATCCGATTGTGGAAGCGTCCGACGCCGGTGATGAAGCTTGCAGAACACCAGATCGAG
GCGTGGAAGGCGACGAGCCACTCGGCTTGGGCGTGCTTGGCAGGTCGGAGCTTGATTCAGCAGGGGCTTGAACTCAGCTAAAGGCTCGATCTGCAttgtg
gctgcagccacgacgcGAGGGAAGCCTGGAACCCTCTCCCCACGaagttcagcagcagcatcgtgcaTATCGGTCTTTGGGCTCTTTACGGAAGACGTAC
CAGTCCACGTACCCGTCGGGGATGGCGCTGAACGACGTTTACGTTTGCCCTTGGACGTAATCATGGGGGCTGAAAGAAACAAATATAGGTCATGCATGGT
TAAGTCAAAGAAGACTACAAAACAAATTTGTAACACATTAGTcgaacaagaacaacttGCCTAAGGCAGTCCGCCTATTGCTAGCTTGAGCGAACTCGCG
GTATGCACGTTGCGATACAGCTAGTCAGCCTCTCGCCTCGTCGGACCAGCTTGATATCTGCCAACGCAAACAACAGATAATTTGCTGGTGGACCATTTTA
AAACGACAGGCCCGGTGTGTGCTTTCTGGCGTGCGGCATCAGTGACTCGTTGGCGCGGTTCCTCGACGCTGCGACTTGGACTTCTCGCCTTGGTATCAAC
ACGCGTTAGTTGCAACAACACATGGGTAAGGTGGTGCTCGTTGAGCTCTCCTACCTGATGTGAAGAACATGATTCGCGCGCGGGGTCCGCGCGCGTGAAA
GTGAAGACCAAAGCCGTTCACGATCGTTTGTACTTCAAATCAAACAACCCCTTTCCAAATAGAGGTGCTGTTTGTACCTACAATGAACTAAAGATATTGT
TTTGATGCGGTTCATTCCAGCTTCCGGGGAAATTGTGCTTGCTCCAGACGATTAAGCCGTCTGCGCTGAAACAAAGCGTACCCGCAACGTAAACGGTGTG
CAGCCACCCGTAGTAATGGGTGTTTGCAGGTTCGGATTAGGTGGTTCCTGGACCTACGAGGAAACCAAAATATGAGAAAGCGATTACAGTTGGGTTCTCA
GTCAGTAGATATAGTTTCACAGCAATCTAACTCTGTAGTAAATTGCAATAGCGGTTCCCGGCGAACAGTAAGCCTCGCGAGCGCCTCTTGTCTGGTTAGC
GTCGACCACACAATTCGCGCAGGAGGGAACCCGATGAACGCAGCTGTCATGGAGTCCTCGGCATCGTTCAAAACCCGACTCAACGTAGGGGAAGGACCCC
GAACATCATACACAAAGACTTCTGCACCATGGACCCCACGTAGAAAGCCATCAACTCGGCAACAAAAGGGTCAACAAAGGGTTAACAATCCCAGTActtg
atgatgatgccgtAGCTTCTTGGGTATACCATCACTTTGTACATGCATTTAGGCTGATGGTGTAGAGAGGTGTGAATCGCTCCAGTAATTGCACAAATGC
CGGTCTGAAATAAATGAACGCCATTCATAATAATTACGTATCTGAGCCGACAGAATCTACATAATAGACTAGTAATCAGCTTACCGGCTCAGACTGGTCA
CATTGAGTAGATTGCCGTCGTCTGCTTTGTGCCAGAACTTCGTCCAGGTCGGGTGTTCAGGGTCGAGCAAGCACTTGACTGTGTGATAATGCCGCATCCG
CACAAGTCGAGCGTGCTCGTATCGCAACACCTCCACGTTGAGACGTCTTCTTAGATATTTAAGAGATGTCGCCAGCCGCTATCGTGTTTGCGAGGTAGCG
GATAGCAGTAGGAACAGCCCTCCTCCTGCCTTTTTCTGATTCCTCCAGACTGCAGAGAAAGCCGAAGTGATAGACGTAGGCGGGGGGTTGGTATCTAAGC
TGGAGGACAGAGGTGGTTGCTAGATGTGGGGAGAAGATGTCGTTCGCGCCTCGTCGTAACTTTAAATTTAGTCACTTTTTCGCGTGTCTCTTGTAAGTTG
CCATAATCAGATCAAGGTAAGTTGTTTCCAGTGGTCACTTAAATTTGAACGGAGCAAATTGTTTTATGAGTTTTCGGACGTTGGCTTTATGACCCCGTCG
TGACTCTCGAAAGTAAACCCTAGCCCTCGACATAACCGTATGATAAAACAAGCGGCTATAAAACCGTTTTATGTAGGTTTTGGAAGACAATGGATATTTG
GTACCACAACGAACGACACATTTATCATGAGGGGCCACAAACAGTGACATAGGGCTAGAATcagctctttctcctctttctgGAGAGTACTTCCATTTTC
AACTGTGAATATCCCTGGTGAtccagcaaaaaaaaactttcacctccagatagtaataatTTAAATGGCTGTATTCAAACTAATGGCACAaaaagaaaat
gaaaaaaaaTACTGCGTGAAGTTGCTTTTGAAGAGCTTTAGGATAAGGCTAACTGCATCTCCAAACAAGCAATAGAACAGAAGCTATCGGTGGTTTAGTG
AACGGTTAATTCTTTATAGGACCGGAGAATTACAAAGTAGCGGTTAAACCcaaaaaataaaacaaaAACGTTTATATTTCTGTTTAGGGGTCTTATAGTC
CGATGGATTactaccgaggggattgtgTGTATACTTAACCAAGAAGAACGCTGCTGCCTGGACTCCTGGCGTTTTGCCGCTGGCCTCTATGCCTGTAGTA
CTCTTCGACATTGCCAACGTCATCCACTTCAAAGACACAAGCGCAGATATGAAGAGTCTATTGGGCTTGACACAAACGATAGTGCGGGTCTTATTTACGA
AATATTAGCAGGcttgaagacgttgaagccGTCGCCAGCCGTGCTCATGAGCACACCTGGGCACTGCgggtggaagtggagctcCTTGATGTCTGTCTGG
CCCTGGTGGAtgaacagcagctgcggcggcAGGTCCAGCTTCGCCTCGCCGTTCTCTCCCTGGACAGGCACAGCGGCCTCAGCATCCTCTTCCACAGACA
TATCCCAGACCGAGATCTGGTTGTCGGCACCTGACACTGCAAGCACCGACTCATCGGTCGGGTGCCACTCGATAGACGTGACCGGCGCCGTGTGGTACCG
GAAGTGCGCCACCGGGTTGTCAGCCTTAAAGTTACGCAGGTCCCAAATCTTGAACGAGCCATCGTCCGAGCCAGAGGCCAGCAGGTAGGCGACGTTGCGG
TTCCACGTGATCACattcacgtcgtcgtcgtgagcAGCAACGTCCAGCATGCTGCCAGCCTTCCGCCGGGTGTCCCAAATGCGCACGGTGCGGTccgacg
agcacgaagcgaACACTGATGCTTCGGTGGGGCTCCACTGCAGGTCCTCCACCGAGCTCTTGTGGCCCGTGAAGGGCACCTTGTCGACGCTCCACGCACC
CTCTGAGTTAGCCCAGAGATAGATGAACTTGCTGCAATCGCCCGTAACCAGACGACCTGCCTGCACAGGAGACCAGTCCATGGCGAAACCCTCGTCAGCG
TGTCCCGAGAACGTGTACACGGGCGCCTGCTTAGCCGGCAGCGGAGCACCCGCCTTGCcgtccagcgactcgagTTGCTTGGCAATGTCCCAAAGGTGCA
CCTTCTTGCGGTCCGACCAGGTGGCCACAATGTTGGAGGACTGCGGCATACAGCGGATGCGGTTCACACCGCCCGGGTGGGAGATGGAACGAGACTCGAG
CACCGGGTCTCCCTCCGtctcgtcctcatcctccgagtcttcgtcctctgagtccgagtcgttattgcgcttgg