Description :
From Genome Similarity Track
Location :
Scaffold_18:143075- 144259
Sequence
1184 bases(100 bases per row)
TGCCTCTACCCAAGCAAGCGCTGCGATAACCTTCGCGTCACCAAGGCCAACGGCCAACTGCACAAATTCTGCCAGTATCACCGTGGCAAGGCAAACTACA
ACCAGCGTCAGCTCGAGTTCAAGCGCCGAATGCAGAGGGAACAGCTGCAGTCTGCTGTCGGACGATGCAGTAAGAGTGATAATCAAGACGACGAAGACTT
CGAGCTGGACGAGGAATATCTTCGTCTTATAGAAGAAGTGGCTACTTCGACTGTTGCAGATGGGGCTTTGCACAAGAACCACTAGTAATACTTTGTGAAA
AACTCAATAGACAATTGATCTTGTGCGTTATTGCGGTTGAAACATCCACACTTGTAGGCGTTATGTCGAAATTTGCTCGCAAATAGTTTACGCTTAAAAT
CAGTTATGAAGATTTGTTATTCTCAGCGCAATACATGTTTGCATGAAACACCAAGGCATTAGTACCTCTTGGGAGCCAGCAAGATACAGCCGATTTTCCA
TTCAATTACTTTCACTACCGGCGGCGGCGTTATTATACAAACCGAACAAGCCGACAACGTCGGTCGGCTGGTAATTTTGCTTCGTACATATACCATCGCA
TACTCTTCCTCCCATACATATCTTCTTGTTCACTACTGTTTGGTAAATAATGGTCGACTGCAACAGTGGAGTTCTACTAGCGCACTGGTTACCTACTGCA
TGCGGGAAATGGCCAGAATAGTTGAGGCCTTACTTGATTCCATGCGCGTGCTGGTCAGTATACTGACCATCGCTACGTTATTGGAAACCGCTGCTGGGCA
CAGCTACAAATTGTCCAGTCAGAATCCGGTCGCAATGCAGGCGATCGTATCGTTTAACCGTTTACTGTGGTAATTCTGCTCATTGGATCCATCAACGTGG
TATCCCTTTGGAGGTTGGCGCTCGAGCGGATCATGGAACTAGAACTTAGCTACCGTCTAAGCCCCCACTTTTGCCCCCCCCCCTCCCCCCACAAACCGCT
TCGTACCCATCAGAGAAGCAGAAGCTTTGACTCAATTTCCATTACTGGGCGTCTTGTTGATTTTTACGCAGACGTGTCGAAATTTACGACTCGTAAATAG
ACCATTACTGACAATCCTGTAGCACAACAGCTACTCTCTACTCTTCATTTAAAAGCGGCGCGAGGAAGCTTTTAAAAACTGCTC