Description :
From Genome Similarity Track
Location :
Scaffold_62:14304- 19153
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_62-abinit-gene-0.33Novel protein
Pytar_ATCC12531maker-par_contig_62-snap-gene-0.12Conserved gene of unknown function

Sequence
4849 bases(100 bases per row)
GGGTCAATGTCTTCGACTGACTGCGGAGCAGTGCACGGAGAATTTGCAAACGAAGCAAGACTGGCAGGTATTTACCCATCACGGCGGTCGTCACTGTACT
ACCTGTCTGACGGAGTCGAAGCCATTCAGCGTCACTCACGACACCATCTGAGGCTGCACGAGAGAGACCGACCAGATCCAAGGCTCTGAGCTTAGAGCTG
GACGTCGCGGAGAGCGAAGTGGCTTGTTTGATCTTGGTATACAAACGACGGGATCCGAGCTCGCTCGCATCCCCGCCGTCCGATGCTCCCAAATGGACTT
GCAGACACAGCAACACGTCGAACAATGACTCCAGCAGAGCCGTGGAGTCGACGTTCCTGACAATCTCGACACAGCGGAGCAGTTGTTCAGCAACCAGCAC
GATCACACGCGGTTGAGACTGAAAGACACGATCCGGTCCCACTCTCACTTTCAGTTGATGCGCCAGCTTCAAGACATTCTTGTTGTTTGGCTCGCCACGA
GGATCCACACAAAGAGCGAACAGAATGCGCTGGGAGAGGAGATCCAACGGTAACGTTTCCACTAGATCGCGCATTACTGGCCCAACGCGCTTGTTCTTCT
TGGCGGCAGCATCCACAACTCGCGACAACGCCACAAGATCAACATCCGGTCGAGCGCCAACATAGTGATGGAGCCACTGGGACGGGAGATGGAGGCGCAA
AAGATCCTCAACGATCTTGGGAAAGTGCTGGACAAACGTAACCGCATCCAGAGCGAATAGCGCATCTCCAAACGCCTGATGGTTCTTCATCGGCTTCCAT
TCACCAACGGTCGAGGTCGCTGGTTTCACTGTTAGCATAGTCGTAGGCGACAGAATCATTTGGGCAGTGGTGATGACGCATTGGAAAGGCGTAATGTTTG
CCAAGTCGATCGAGTCACTGCGCCGACGTTTCTTTGTCGATCTTTGCCCGACATCTTCCTCCGCGGTGTACACACCGTCGGCGCTAAGAAGTCGAGCTAC
AAGAGTCGGCTCCGTATTTTGGCACATCAGAGACATCAACACGCGCGATGCAAACGCGGAAACGGCGACGTGCTGGAGTAGCGCATTGAGTCTGGACACC
GACCGTGAGAGTGGCCAGCTGTTCTTCATCACCGCAATCAAGGCTAGCGTTGCAGGACTGGGTGAGACCGACTCGTTTGCAGACGTCAACAGAAAAGAGA
ACGGATCCGATAAGACATCATGCAGAATCGTCTCCACGAAAGCGGTCGTGGTATCCCCACCGGTCGCCATGTTGTCCAGCCAAACGCTGATTTCTTCGGT
TGGTGAGGACACGTCAGTACTGGAACCAAACACCTTCAGCGCGACAAACACACGAAACAGCACCGCTCGGGCGAGCGACCGACTGGCCTCTCCAGATTGC
ACAGACTGGGACGTGTAGATGCGCAGCAACTGACTCAACTTGGAGACTTCGCCATTACCGACGGTGCCAGATGTTACAACATAGCGAAGCCGTGTCTCGT
CAACGACCATCAGCACGCGCAGGATCTCCCCGACGATCACTCCGCGCATTGCGCGACTTGTGTAGCCATCGACGCTGTCCAGGTATTGCCACGCGAGCAG
CTTCGTGAAGTCGGCTTTAGATTCGCTCATGGCCAACGGCAAACACTCCAAGTATAATCGAAACACGGTGAGAGCACGGAGGTACACCAGCGTCGCTTTG
TCAACACTTGCACATAGCTTCATCAACAGAGAGACGAGCGTTTCCGGGCTTGGCAGGAGGAAGCGGAGTTCGCTCTCGAGCTCAGATCGCTGGATCTCTG
ATGGCAGGTTGGACTGCACAAATTGGAATCGGCGGAGTGCGCATTCGATCAATCCGAGCGAGCCATAAATGATGAGGTTATTTACGTGCTGCAAGCCACG
GGAGAGTTCCTTGCGGCAGTTGACTGGCATAATGAGGCGCGACGCGAGTGCCTGAGCAGTGTACGCAGATGCCGAGTCGCCTGCCTGCGACACTGATGAC
TGTAGATCCGTGACAATGGCATCAAGCGGGATCGACAAAGTGTTCTGGATCATGGACGCCACGCAGAACCATCGATATCCGGTCTTGGGCTCGAGCTGTG
ATCCTAACGTGCCCAAGAACTCGCCGGTCAGGCCCGGGTACGCGAGCAGCAACTTGAAGACGAGGCTACGAACTTGACTATTGCGAATATAGTCGTTGAG
ACCAATCGAGCCGATCACGCCGCGAATGATTTTGGCTGCCGCATTCGTCGATTCAACAGAGACTTCATGTCTGGTGGACGCTTCGAGTGCTTCGATCGCC
AGAGCCGAGTTCGCGGCGGGCTTGAGTAGGAACTGACGCAATGACTGGTGGGCGGGCACGTGGTACAGCGCACCGTCTTCCAGCAAAAGCTTCGACAACA
TCGATGACGCTTGGCTGGCGACGTCTTCGTCGTCCGACTTGAGCACAGCTACGAGCTGCTGGACGGTCGCATTGTTGAGAATGACCATTCGCCCGCGCAA
GTCTAAGTTGTCGTTGCGCATCACGAGCGTCTCCAGGTGATTGGCCACAATCGCGAGCATCTCCGCGTCATCGCCATCTAAACTCTTGAACAGCGAGGCC
ACGACGCCACCATCTTTCAGAGCGAACCGGTGGACGCTCCTGTCGGGGCACGCCGCGAGCGCGGCCACGAGCCGTACATAAGCCGCTCGGATCTGGAACG
CTGGTGGTGCTGCACTCTCTGTCTTCGTTGGCTTGGTCGTCGAACTCGTCGTCGTGGAGAGCGCGATGCCATCTCGCTCCGGTGATTCATCGTCGTCTTC
CTCGACCTTTGCCACCACGGCCTTCTTCATGCGTCGCGCTGCAATCTTGATGAACGACGCGCTCTGGAAATTGAAAATACGCACCAACTCACGCGCACAG
CTTGCGCTCACGCTCACGATGGTCGCCATGAGCTCGAGCACGCGGAACTCGACGATGGGCTTGTCGCTCCATGAGAGCATCTTCTCGAGACTCGCGCTTT
TCTCACGGACGATCTTGAGCGCGAGCGCCTCGGCAGCGTCCTTTGCCAGTCGTTCATGGGCCTGCGCATGGAGCAGCTTGGTCACGAGCTCGAGGAAGAG
CGCGATGCTCTCGCGGTCCTCCCACCGCGAGCCCTTGCCGGCCTCGTCGGGCCAGTGCAGCACGAGCGGGTCGGCCTGCGGGCTCACATCCAGCAGCGCC
GTCAGCACGCGCGCGTCGCTAGCCACTGCCTCGGCAAACCGCCTCACGGCCGCATCCAGCGGCTGCGTCGAGCGATCGGTCGCGAGCAGCAGGTCGCGCA
GCACGGTCGCCGTCGCCGCCATTATGCTTGGTCCGGAAATGGTGCCAAAGGCAACTTGGCAGACAACCACCGACGTGGTTGCACCTCAAAACCGAGGTTT
TATGATATGTTAACGTACGCGGATCTGGTTAACTCTGGAGCACTTGGAGATGGAGCCGCGCGATGCGACTGGCGAGCCTGTGCGCAAGACGGCGGCGCTG
CCGGGCTTCGTGTCGACGACGCTGCTGACGTCGTCTGATGGGGTGCGTGGGTATTCGTGGGTACGCTAGCGACTGGGTTAAGATTGACTGTCATTGGATG
GTGAGTAGCTCTTCGGCGACAATGTCGAGGAGAAGCGCATCTCGGATGCACCGGCGCCGAGTCTGCGCGACGCAGACTACAAACCGCTGTACGACCGCCT
CAAGGAAATGAATGACCAAAAGGACAAAGACTGGAAGGACAAGAACAACCCGTTTGGTGCGTTCGAACTGTGAGAGACTGGCGATGTCTGTATGCTGACG
CTTGGTGCGAGTAGCTCCGCCGAAAGCTCTCGATGACGAAGAGGTCGACTTCATTCGCGACCTGGAGAATCGCCAAGCAGACAGCCAGAAGCAACGGAAA
GCTCAGGAGCAAGAAGACCTTGCCGAATACTGTACGTTCGGATACCAGTATTGACTGAGCAAAGGCTTGTCTGACATTCGTCCTGCACTGTAGTACTCGC
ACGGGAGTCAAGCAAGAGTCAGACAACGACGACGGGTGCGCAAACGTCTTTAAATGTGCCAAAGCCAGCTACGCTCTCCGATATTGTCACCAAGAAACTA
TCGGTGAAGAAATCTGCGGCGCCTGCCGTCGTCATCAAAGGGAAGCGGAAGCCAACGGCAAAGGAGTCTGCGGATCCCAAGCGAAAGAAAACCGAGAATG
GAGCCAAGCCTGTCGCAAAGGTCGCAGGAGGTCTTGCTCTTGGTGGGCTGGTAGGGTATGGGAGTGACAGCGACAGCGGTAGTGACAGTGATGGACGATA
ACGATCTGGATGTAAAATCTTAGTATTGCACGGCATCTAAATCAGATGATGTCTACTTTGGCATCTGCGGGCCGGGGCGACGAAGGCTTCCGGTCGCGAA
TGGATTGCGAAGTGGAGGTGAGGCCGCAACAAGGATGCGCGCCTGCGATCGCTGCTTCCGCTGAGGCCGATCTGGTGTTCTCATCACAACAGAAGCCCGC
GACAGTTGGGCAGTACTTGGTGCACTTGCCCTGGCTGACGGGACTGGTCGTGACGAAGAGGCCACTCCGTGGGAATTGACAGAAGAAACCAGCGCTGCTC
CGCTCGAAATCACTTTTCGAATTGGAAGCATCTGACGATCCACGTTGCGCACAAGCATGGGCATCGCCATCGCCTTGGGGAGTAACGAGTTCGACGGCCG
ACCTGGCTTGGACTTCTTAGAGGCGGCTGCGAGAGACATCAATGACGAGTCGGACGCCCGGCGTTTGGTCGGTTTTGATGGCGCAGGATTTCGTTCAACG
CGCTCATTAGTTAATGAAGGTGTGACTTCATGCTTCCAAGCATGCTGCT