Description :
From Genome Similarity Track
Location :
Scaffold_80:14304- 15815
Transcript NameFunction/comments
Phyke_g3622hypothetical protein PHYSODRAFT_257850

Sequence
1511 bases(100 bases per row)
GCAGTCTCTGAGTGCATTTGGCGTTCTAGTGCCTTTTGCGCTTTCTGAACGAGCAGCGCAAGTAGCGACCGGTCTTTTGCAGGACGTTGTTTGAGTTTCT
CTGGTGCTGGTAGTCTTCGGTCCACGGCTTCTTGTACTGCACGAGGCAGTTCTCGCGAAATGAATTTGAGAATCTCCACACGGTACATGCAAGTGGTCTC
CGGATCCACAAGCATCGAATCCGTAGCCGTGGTGGATGCGTGCATCAGTGCAAGTTTCTGGCGGATATCCGATCCCACCGCTTCAGCCACGGCATCGGCA
TCAGCCTCTCGCGTTGGTTCGCTCTGGTCGCGGTGCACTCGCAAAAATCCCGTGACACGAGCAGTGATGCAAGCTAACAATTCAGCACGGATCTCCGAGG
CTGCAAGGCTCAGTTGGCGAACTGCTACATCCTCCGGTGAACGAATGCCACACCCTGCTGATAGATCTAATGTAGAAGAATTTGAGTCCACGCGCATGCG
TTTCAGCGGCGACTGAGTTGGCTTTGGTGATGGATGGCTAGTTTGGAACCAACGGTGTTGCTGGCTGGGGTTATTTCCTGACGGGGTAGTGCTCATGAAA
CTGTAGTTGGGTCGCGGACTTGGGCTAGGTCGAGTGCTAGGGCTCGAATTGACCATGAGCGATTGCACGGGTCGAAGATGAAAGGAGCCTGAGGCAGGCG
TTCGGGGTGTTCTATGCCCTGCTGACGGTGTGCTCTGAGGTTGGATCCCTTGACGAAGCTGTAACAACGCCTGTTGAGGTCCGCTAGAGATGGTTGTTGG
GCTGAGCAAAGCTAGTGATGGCAGGGCCTTATGCTGGAACGGTGCTACTGAAGGTGAGTTGACATAGGCTGCATATTCCTGTCGGTTtgcgctgttgttg
ctgctgtcgtgttCTCCGTTGAAGCGCATCAAAAGTGTTTGCAAGAGTCCTGTTAGTTGCTGGTTcgtcttctggatcttgcGCATCTCCTCCCGTAGTC
CCCCGACCTCCAACTTCAGTTCCTCAAATTCCACACGGTCCACTGGTGTGCTGCCTCCGACTGGCGTCGATACTCTCCCATCACTCGGAGATCGTCTCCT
GATCTCACACAATAAATCTCGTCGTCCACGCACGAAGCGTTCGTGACGGAACTCCCACCGGTCTTTGGGGCTGTTGTCCTCGTCCCCTTCTCCTTCCTCC
GTCACCGCCCCAGCTCGAACTTTCCGGAATCCATATAGATTCAGCTGCCGCACAAAGGAACTGAACTTGCGGTGCTTGAAGTACGTAGGGATTACATGTT
CCGCGAACGGCGAGGGCTGCTTGACCACGAAACTGTCCCCACGAGGTGTCCAACTGGCCAATTCAGGAGGACATCGCTCCAGTAATTCATATGTTTTCTC
TAAGAATAACGCTGCTTCCTCTCTTCGTGGACGTTTCACTCCTCGTCCAGCTGTCTCAGTGTCCTCCGGAGTGTCCACACTGTCAACTGGTGGGGAGACC
GGCATGGAGGA