Description :
From Genome Similarity Track
Location :
Scaffold_1392:1430- 3841
Sequence
2411 bases(100 bases per row)
GTTTGGATAGATGACCTGCTGCTGTTTGCCAATACCGTTCCGGACTTGCTGATCACGATTGAGATGGTCTTGCAGAAGCTCGACAAGCATGGGTTCGTCC
TCAGTCCTAGAAAAACTGCAATCCTCTTGACTGAGGTGCGGTGGTGCGGTCGTATTATTAACGAACACGGGATCGGGCACGATCCCAAGCGCATCGAGGC
GCTGCGGCGTATCCCGATTCCGTGCACGGCCGCTGAGCTACAACAGTTCCTGTGTGCCAGTAACTGGATGAGGGGAGGACTGGTTGACTACTCTCGAGTG
GCTCGACCGCTTCAGGAGCGGCTTGACCAGGCATTGGTTGGCACACGCAAGAGCAAGCGTGCTGCCGCCGGAATCAGAATTGAACTGACAGCGGATGAGT
GCGCCAGCTTTGACGCAGTGAAGGACCTGCTGGCGCACTCAGCTATGTTATCCTATCCCGATCCGGCGAAGCAACTCTGCCTCCTCACCGATGCGTCGGA
TCGGGGCTGGGGGCTAGTGGTGACCCAGGTGGCGGACTGGAAACCTGATATACCCATCCAACATCANNNNNNNNNNGTGTTATAGAGAAAGAGTCGTACC
CGATCGTGCACGCATGTGAAAACCTAGAATACCTACTGCTCCGGCAACAAGGATTCAAGATCTACTGTGATCATAGGAACATAGTGTACCTATTTGCTCC
AGGCAGAGAATTGAAGAAACATGTACGAGGCAAATTGCTTCGCTGGTCGACCAAGCTATTAGAGTACAAGTACACCATTGAACACATCGACGGGATACAC
AACGTTTGGACGGATTTGATATCGCGGTGGGGTGGAACGGCACCACCAGTCACACGAATGAGCTCAACCAAGCGGTTCACTCGCAATACTAGGAAACGGA
CGCGCTCCAGCGCAACCTCTCGTACAACCACACCAGGACACATTGCGCCTCTACCGCCGCGGCCATTGGACATGGACGGTTTTGTGTGGCCGACGCTGGC
CGAAATCGGCAGCGTACAAACACGGCACACTCCGCCCAGCGGCGCGACGATGGACGGTGACTCTACCTGGAGGGTGGATGGACTGATTTGGATACCTAGT
GGTGAATTGGAGTTACTGCAACGTATCATGGTGATTGCCCATTGCGGTGCCAATGGGCACCGTGGGATTCACGTGATGGAGAACCACTTACGGCGATTAT
TTTACATTATCGGCCTACATCGGATTGTTCACGACTTCTGCTTGAAGTGCTTACTATGCCTACATGTAAAAGGTGGATTGATCATTCCTCGCCCATTTAG
TGAAACACACCACACGTATGAACGGAACGCAACGTTGCACTGGGATTTTCTTACATTAGGTGATTCCTTTGGCACATCGAAATACGTTCTAGTCATGAAG
GATGAAGCTACTCACTACGTTGAACTAGTGGCGTGCGACGGCCCAACAGCGGAGGTGGCGGCTGCCGCCATTCTCAATTGGTACAGCCGATTCGGAATAC
CGTCACTCTGGGTGAGCGATTGCGGCTCACATTTTAAGAACACTGTGATTACAGAATTGAACCGACGCCTAAAGGGCAACCAAGAATTTATTCTCGCTTA
TACACCATGGAAAAACGGCTCGGTGGAGCGTGTGAATAGGGATATTTTGCAAATTTTAAAAGCTCTCGCATTGGAATTTAAGGTGAACATACAAGACTGG
CCATACCTACTGCCGCTCGTACAATCGAGTATCAACCACTCCCCGGTACCTTCACTGGCCAACAAGGCCCCGATTGAATTGTTCACTGGCCTCCCGTGCC
CGACCCCATTGGACACGGTTGTCCTACCGGGTGGAAAAGGGCGGGTGGCCTCAATGCCACCGCACCGACCTAACATTGAGACGCAACTTAAGAATTTACG
AACACACATTACTGAGTTGCACAAAGCTGCCAAGGGCGAGCGTGACCGCCATGCACAGCGGTACCGTGCGCGGCCGCACCACGAACGCCCAGTCAATTTC
TCTGTTGGGGACTATGTTTTACGATCACGTGTGGATGAAAAACTACACGCAAACAAGCTCAGAATTATGTGGGTCGGTCCATACAGAGTGATTACAAGTG
CAGAGTACTACTTTACTATTGAACATTTGGTGACTGGACACACCATGGATGTGCACCCATCTCGACTAAAGTTTTACTCAGATAGTACTCTTAATGTGGA
TGCAGTAATGATTGATCACATAGCCTCTCAAGGGACTTTGATTGCCGTGGAGGCCATCATGGGACACAGGATGAACTCAAATATGAGGGCCTATGAGATC
AAGGTCAAGTGGAAAGGTTTTGAAGCTATTGAAGATTCATGGGAGCCCCTGAGAACGACTAGTAATGACATACCGCAACTCCTGATGGAGTACGCCAATA
TCACAGATGAC