Description :
From Genome Similarity Track
Location :
Scaffold_1742:1430- 2499
Transcript NameFunction/comments
Phyta_totarag13585hypothetical protein

Sequence
1069 bases(100 bases per row)
CAAGAATGGATGGTTCAATAACCCACATTCTCCGGTAATCGGAGGTCGACGGCGATGATCTCGCTGCAAGCAGGAACGAATCACGTCTTCCAGGTCCTGG
TTCTGTAGCGGCGGAAACGGAATTGGCACTGTCGGATCGATAATGCAGCGAAATTTCTCAATGATGCTGTGCACATCCGCAAACGGGGGCTTCGAATACA
CAATCTGGTAGAGAATGCACCCCAACGACCAAATGTCACTTGCGCGCCCAACCTAAGCAGCAAACAAAAGAGCAAGCGAGTAGGTCAGCATGAACCTTCG
TTTACTTCACGAATATTGTCAGCCCCACCTTCATTTTTCCTTCAGGATCGCGCTGGCCGTTGGGCATTGTGTTGCCCTGAATTGCCTCGGGGGACATGAA
ATTGACCGTACCAATCTGACTGTCGCGCTCGATGTTTGTCGTGTCGTTCGAAGGAATTGCCTTCGCGATTCCAAAGTCAATAAGCTTGAGCGCACCATTC
ACAAACAAGAAATTTGCTGGTTTTAAATCACCTGGAGAGGCATAGAGCATCACATGTAAGCACGAGGAGTGTCACTCATGATATCAACAAGACTAACCGT
GAATAATTCGCATTCTGTGAATGGCGTCTACAGCTTGGAGCATCTGAGTCCAGATCACCCGTAACAGATTCTCATCCATGTCGCCCTTCAAATCGCGAAG
TCGCTCGCTCAGGTCGATCTCACCGTGTTCCATTATCTAACACAAGAAATACACAGCACCATAAACATTAATACACGCTATGGACACATGTAAAAAAAAA
GTAGTGTGCACAAGCCTACCACGTTgatctgtcgctgctgaagatccTGCTCGGCAGTAATAAGCTTGATGATATGCGGGTTTCCTTGCAACTTTTGTAG
CAGGTTAATCTCGTTTGTATACTGGGCAATACTTTGCGCATCCAGCTTTTTCAACTTGATTTTCTTCAACGCGTAAATCTTGAGATCTGGGCCAAGCATC
CGATAGACTTTACTGCTACCACCACTCCcaatctgctccagcttAATATACCTCTGACCGTTCACCTAC