Description :
From Genome Similarity Track
Location :
Scaffold_578:143- 3427
Transcript NameFunction/comments
Phyag_g6776conserved hypothetical protein
Phyag_g6777conserved hypothetical protein

Sequence
3284 bases(100 bases per row)
GATGgcgagcagcggcgtggacgtggcgctggcgccCAACTCGAGCGTGATCCTGGAGCCGGCGGACTCGCTGTCCTTCCAcctgcagccgtcgacggCG
CCCCAGGCGGTGCTGACGATCCGCAACGTGGCGGACGACCGGCAGATCGCCTTCAAGGTCAAGACCACGCGCCCTCTGCGGTACCTGGTGCGGCCCAACC
AGGGGCTCTTGGGCCCCAACGGGTCCGCCTCCATCATGGTGATTTTGCAGCAAAAAGActgcgacgagctgctgcgactggaCCCGGCCGAGCGCCAATT
GGCCAACGACAAGTTCCTGGTGCAGAGCAtctacgtggacgacagTTTTTACGAGCTGGTCAAGACCAAATCCACCAAGGAGATGGCGGACGAGCTCACG
AATATGTGGGCGAGGACGGACAAGCGCGCGCTGTCCAATAAGAAGCTGCGTTGTCGCTTCGTGCAGGACAACGAGGAGCCGGCGGCGCGTCCGGCGTCTC
CGCCCAGTCCACAGCAGCGTGCAGGATCAACGAGTGCTTCGCCGGCTATGACGACGGCCAATTCGGACGCACGGTACCAGAGTAGACAGAATGAGGCGGC
GGAAGTGGCGACACCTGCGCAACTGTCGTCGGCGTTGTTGCAGGACGACAAACCGCCCGCTCCGAAGGTGGCGGAGGGCAGAGAAGGAACTAAAGAAACG
ATCCAAGAAGTAGCAGCTCTGCGCAAGAAAtacgacgagttggtggcgttcaCGGTGCAGTTGACGGCACAGCGGGACGTGCTGATGAGCGACCTGGACA
AGACCAgacagctgctgcagaaggcgaGTACGGATGCTCAAAGAGTGAAGAAACTATCGGAGGAGACGTCCATGCTGCGTCATCGGAAAAACGCTGGTGG
GAGTGGGGTGTCTGGGAGTGAAGACTCGCAGGCGATCACGGGCAAGGGGCCGAAGGAGCAGGGGGTACGTGCAGATAGATGGATGTAtttggtggaggtg
ctggttACCTAATTGTTGGTGTTACAACAGGTATTCGGACCTTTGCATCTGCTGGTGTGCGCGATCATTTTCTTTTTAGTTGGGCGCTACTACTAGGCGA
CTTGAAGTGTCGTGTGTGCTGGGATTAGGCAGAAGACAGAAGGTGTTGCAGCTGGAAGGCAACAGGACTAGAGCTTTCTGTCGATCTGCATGGGCGTGCC
CGTGCTCGTTCGTGTGTACGTAGGTTCACAGGTGGGGTAAGCTTGGTTTGCTCGTAGTAGAGGGTGGTCACAGAACAAGTAGTTAGTAGACCGAGTCAGA
TACAAGAGACCTGGGGAGAAATCAATGAAtatggcaacaacaactccacaacaagaagaatGTGCATCGAGAAAGCAACAAAGCTGCAGGTGAACTTGGT
GGTGCATTTGATACTTGTAGATGAACCACGAAGCTGTTCACGTGTACATCGCTGAGGCTTCCCTGTGCTTGCACCCACCTAGTTTAGAATCGCGGTGACA
CTCATCTTGCGCTTGCCTTCCATAGCTAGAGGCGCACAAGCCTTGCGCTTGGCAACCCGCGTTCGGCAGCTTTCCGATGCACTGTCACCACCGTCACTGC
TGATTCCAGACGCGTGCAAACCGTCCTTCATGGAAAGCATAGcaatcgctgcagcgtcactATCCGACTGAGTGCCAGCGGAGGCAGCACGCAACGGCAG
TGGAGGCAAGATggtcttttcttcttgaggacGACCGCCGAAACGCAGTGGTGGCACTTCTGTGTCATCATCAGGGAATACTGCGTCGTCCGGGTTATCC
TCGTactctccatctccgtcaTATGCGCTCTCAATCTTCCTGAGCTCCCGTACATCATCTCGAAGAGCGTTCACCCGTACCAGTGTCACCGAATCTTCCG
ATCTTGGCGAGGCTTCATCCACAGTGCTTCTATACCTGCGTCCGTCGCGACGTCCTCCACTTGCACCAGGTGGAGTGTGACTTGGGGAACGAGTCGCAGA
ATTGTTGTTGCCAGGTGAACCAAtatcgccaccagcaccgccagtAGACGATCCATTACCAGGTGCACTTCccgaaggtgaagatgacgaacTGCCTCCT
CCCCCACTGCGTCGAGACGACGACTTTTGCGCATCGTGTTGCTCAATACTCGACCCCGTAGCTTGCATGAAAATATGCTCCAACCGGTCGATCATTTGCA
GCAGCGGTTCGTACGTCGCAAACGGCTGTTTCATCAAGATCGTGTGCATGAACTTGTTGCGCGTGGCATATCCCGTCCACTTGTCGTGCTTCTTCAAAAT
CTACAGCATAGCAAAAAAATCCAAACAAAAAGTGAGATGGATAAACCAACAATATTTTTGCAGACGGATATGCTGCCAGGAGGGACGAACCGCCAAATTG
GCTAAAATCCAACCTTAGAAATACCGCAAAAGTTCATGACGGCAAAGTTCTCCAGCAGTAACAGCTCCTTGTACAGCGCAACGCAACTCTTCATGAGTGC
TGTCTTCGCTTCTGCTGACTCAGGGTTCGTCTGCGCAATAAAAACATGATAAATAAATTTGTGCAAATGAGTATAGTGCAACGATAACGCGTATCCATCA
ACAGTGTTTTTTGAGCCGCACCTTGagttgctggaagctggCGTCGATGGCTGCCACCTGACTCGTGTGTCTCGCTTGCTCCTTGATAAAGAAGTCGGCG
ATTTTTTTAATCTCCATGCGCAAGGTGCGAAAGAAGTTCATCTCGTCTTGCGATTGACCTGCGCAAAAGTTTATCCAGTTTATCCACCGATAAACAAACA
GCAATGTTAGCAAGTGCTGAAGCCAAGTGCCAATATCTATGCAAAAATCCATCAGTCAGCGCAACGTACGGATGCTGTCGTTGTCCTCTTTGGCGGACGG
TTTGATCTTGATCTTGACGAGTTTGTCgccctgcagcttctcctccttcttgatctgcgCGCAGTCCTtgatgatcttcttgagcagcttgtaGTCGGCC
CAGTAGGGCTCCCAAGCGCTGGGCGACATTtgcgtcgactgctgcaacactTTGCCGAACTTCATGGCTGCTTggcgattgctgctgcgttgcgtTGCGC
GTGAAGGAGGCTATTTGCAGTCTGCGGAAGAAGCGCCAAAACAACTGGATAACCAGTCAGTTCAGAGCGCAAGCAAGAGAGGAACTTGTCGTGGTGTGTT
GCAGAGCGCAGCGGAGCGGGGGCACCTGGCGCCGAGATTCGATGCAGAAACGAGGAGCCGACACCTGCCCGAATCTTTTAGGTC