Description :
From Genome Similarity Track
Location :
Scaffold_363:143- 2954
Sequence
2811 bases(100 bases per row)
CCATTGGTTTCGAATCGCGAAACCTATAGAAATACAACTCACTTTTCAATAAGCAATCCCGGTGAAAAGCCGTCTTCGTTTTTCAAAGAACGCTCACTAC
TATCTTCCCTCTCAACACATAATGCATGAATAAACGGACGCAGTCAAGTGCGATGGCGTACTGGTTGAAGCATACTGTTTCACCGTCTACGCCGCAGACA
AAACTGACCGGAAGTCGGTCAGAGGTGGCGTGATGAAGGTGGCTATGCAAGCAGCAAAAGTGTATCGTTCTATCAACGATGAAAGCAGAATTTGTGGCGG
CTTCACGAACAGCTGCTAAAATGATGAGTATCATTGAACTACTACAGGAGATTGGCGTATCGGTTCAGCCTGTTCAATATTGCACGTCAACAATCACACC
CCCATCGATCAGGTCAAGGGCGAGGACACGTCCGACCGATCGAAGCACATCGATGCGCGATTCAAGTTTATGAAATATTTGAAAAATGAGTTGCTAAAGT
GCATATGGAGATATAGAGTATGCGTGCAACATACTGACCATACCTCACAGCGCTCGACTAGTCAGCTCCGCTGACTTTGATGCTTCAGGTANNNNNNNNN
NTCAGCTGTAAATGGGTTACAGGATTAAGCGCAATCCAAGCGACGAGATCGTCAAGTTCAAGCGCGCTTGGTCGCCAAAGCTTTATTCAGCGACCAGGCA
TCGATTACACGAGACATTCGCACCAGTGGCACGCAAGGAATCGATCAACACGGTGCTAGCGATTGCGGCTGCTGAAGACTTGGAAGCAGAAAATGTGGAT
GTGGACACTGCTTTCCTGTATGGTGAAGTAGATGAAGAGATCTATATGGATCAACCCGATAGATTTGAAGACGAACACAACTCGTCGAAGAAGTGCCTGC
TTCAGAAGGCATTGTACGGAACCAAGCAAGCGGCGAGACAGTGGAACACAAAGCTGAACGAGCATCTCGAGAATCAAGGTTTCAAGAAAACAGCTGCAGA
TCCGTGTGTCCTAATTCGAGTATCAAGTACGGAGTACAGTATCCTTGTCATATACGTGGACGACCTGATGATCTTTTGCAAGACGAAGGAGCACATTGCA
GACATTAAGATAGAACTGAAGAAGGACTTCAGCATCAAGGAGCTTGGTGATCTCAAGTACTGTCTTGGTATCGAGATACATCGCAAGCGAAACGAGAAGA
TGATCATGATGAACCAGCAGGCGTACATTCGAAGACTTGCGGAGAAGTTTGGAGTACAAAATTGCAAAGATGTTCACACACCCGCTGACAGTAATTCGAA
GCTGGTCAAGATACCCAACGGTGAAGTGTTTGTTCCAAAGTTCCCCTACCGTGAACTTGTAGGTGCACTGATGTACGTCGCAACATGCACGCGACCGGAC
ATCGCGCATGCAGTTGGTGAAGTGGCCAAGTTTTGTGAGAAGTATGAAAGTCGCATTGGGCGGCTGCCAAGAGGATTCTCAAGTATCTCAAGACGACTCA
AGATCTACGCATCAAGTTTAGCGGCAACAGCAAGGGAGAGCTCATCGGGTTTGCCGACGCAAACTGGGCAGGTGATGTCGACACCCGGCGCTCAACAACT
GGCTATGTCTTCTTCTTGAACAGCGGCGTGATTTCGTGGAATTCCAAGCGACAACCAACGGTGGCAACTTCAAGCACTGAAGCGGAATACATGAGTCTGT
ACAGCGCGACTCAAGAGGCAATTTGGCTACGGCTGCTTCTCAAGGATCTGGAATATACCGATAATGCGGCCACGACGATCTTTCAAGACAATCAAGGATG
TATATCTTTGGCCAAGAACCCGGTGTATCACGCGAGGACGAAGCATATCGACATCAAGTTCCACTTCTTACGCGAGAAGGTGATGGATGAAGTCATCGTA
CTAGAATACAAGCCGACTGAAGAGATGGTCGCGGACGGGTTTACGAAGGCGCTACGGAAGGACAATCATACCAAGTTTCTCACGACATTGGACTTGACGG
TGTAGGCATGCACACTTCGCACGCACTTCAAGGGAGAGTGTTAGCAAGTGATGCTGCAGCGATGTGTGTAAGTTGCATATTTCATATGAGGAGTAGTTGT
CGATTTTGTAGGTTTGGTTTAGTGTGGGACTTGTGTGCAGGTACAAGACATCGGATTGGCTCAGTCGTCTGGTTAGGGCGATATCACGCGGCTAATTGCG
GGTTCGAGTCCAAGCGTGGTAAAGTTAATTGTGACTAATACTCACGACCTGGTGTTTGGGGTTCACCAGAATTTCGACCCTTCCGAAGCTACGTCCCCCA
CTCCACGCAAGACACTACCATTTTGGATAAGACGTAGCAGAGTTTTTACTGCAGATATCTTACAAGAAGTAATTACTCAAGGGTAGGACTAAAAGTCAAG
GAGGAGAAAGGACAGGTAGCGTTAGTGGCTGGGAGCCATCGGCTTCTGAGAGCCATTGGTTTCGAATCGCGAAACCTATAGAAATACAACTCACTTTTCA
ATAAGCAATCCCGGTGAAAAGCCGTCTTCGTTTTTCAAAGAACGCTCACTACTATCTTCCCTCTCAACACATAATGCATGAATAAACGGACGCAGTCAAG
TGCGATGGCGTACTGGTTGAAGCATACTGTTTCACCGTCTACGCCGCAGACAAAACTGACCGGAAGTCGGTCAGAGGTGGCGTGATGAAGGTGGCTATGC
AAGCAGCAAAAGTGTATCGTTCTATCAACGATGAAAGCAGAATTTGTGGCGGCTTCACGAACAGCTGCTAAAATGATGAGTATCATTGAACTACTACAGG
AGATTGGCGTA