Description :
From Genome Similarity Track
Location :
Scaffold_901:143- 1368
Transcript NameFunction/comments
Phyci_138101Hypothetical protein

Sequence
1225 bases(100 bases per row)
caacgacagaccgctctgacgttgaaacaccttcgctcgtccaggctgctgccaccaaaagtcggtgtcgggtcacatgctggccaccgaattttggtgt
ggcactacaccacaCCAGGACTACCAGCCTCATTAGTCCATCACGATCCGACTCGGATCTCTTCGTAGGGGGGCAGTAGAACAGCAGATCGCTCAGATCC
ACATCATAATTCATCGCGACATTACCGTAGGATCTGGCCTCTTCAGGCGTCAAATCTTGCACCGAGCCCATCAGGAACTTCTTGAGACCCCATATCCACG
CCTCCTCATCTTGCGCTTGCCGGATCCGCTCGATCCTCATCTCTATCACCACTTCTTCCTGAAGAGCGGACGGGGTGGATCTGGGCCTGGATCCAGATCC
GGCACCGGACCTGGATCTGGATCTAgatccagcgttggatctgatggtcacgggcgagatataggcttccgagtcgtcgctttccgcctccgtcaccaag
atttcatttagacggttcagggtgaccagatcctccagatccttcggctcatccatcaggatcccaccttgccgctgcaatgccgcactcgcaaggctat
cagcgctgctgttccagtcgcgtttgacatgtaccagctcatgatgtggtcagatccgcagtcgatccaacgccttctgtctcaacaacgtaagccccgg
cgccttgcagtcgatctctcctcgcacgtggcggatcaccaaattcgagtccccacaaatcactagtcttcgcagatcctccccttccagcagatccatg
catagtactcaaccatgatattccgcctcgttaacggtcagtccttcggcgtagccggatcgtgccctcacaatattccactcaggtaatttccacaaaa
tcgcgctgtaggcacctccaccacgcttgacgcgcgcagatccatcgaaactggcgacaaagagctcttcgtctggcttaacggtcgggatcggcacttg
gatctggcgtttaggctcattcttaggtgcgatcgcaattaacgcccgatccacctcagacctgggagtgatactggctgtcatcgcgcccaggatctcg
tcttcacctttgcttcacttcacagtttcgagtgtccgcgggggcaacaaggcggcccactgcccaaggcgaccttgtaaacctggcgacacgccagcgt
agagtgtcttgttagaacccggatc