Description :
From Genome Similarity Track
Location :
Scaffold_2504:143- 1253
Transcript NameFunction/comments
Phyta_totarag14561hypothetical protein PHYSODRAFT_538218

Sequence
1110 bases(100 bases per row)
TTTGCCTCACTGCCGCTGTCCGAGCCCACGCGCAAGGCGCTGGCTGACATGGGCTTCACTAAAATGACCAAGATCCAGTCCAAGTCGATCCGCCCGTTGC
TGGCTGGCCAAGACCTGCTGGGTGCGGCCAAGACGGGTTCTGGTAAGACGCTGTCGTTCCTGATTCCGgccgtcgagctgctgcacaaggtGCGCTTCAC
GGCGCGTAAGGGCACGGGCTGCATTGTCATCTCACCGACGcgcgagctggcgctgcagattTACGGCGTTGTGCGCGACATCAGCAAATACCACTCACAG
ACGCATGGCATCGTCATGGGCGGTGCCAACCGTCGCGCCGAGGCGGAGCGCCTGGTGAAGGGCGTGAACATTCTGATCTCTACGCCTGGTCGTCTTCTGG
ATCACCTGCAGAACACGAAGGCGTTCATTTACCACAACCTCCAGATTCTCGTGATCGATGAAGCCGACCGCATTCTGTCCATTGGTTTCGAGGAGGAGAT
GCGTCAGATCATCAAGTGCATTCCGAAGGAGCGCCAGACGATGCTATTTAGTGCCacgcagacgaagaaggtggaggacCTTGCTCGTCTATCCATTAAG
GAGAAGCCTGTGTACGTGGGcgtggaagaggaggacacCAAGGCTACGGTGGCCACGCTGGAGCAGGGTTACGTCGTGACACCGAGTGATaagcgcttcc
tgctgctgttcacgtTCCTCAAAAagaacctgaagaagaaggtgatggttttcttctcgtcgtgcAGTGCTGTCAAGTTTTACGGTGAACTTCTCAACTA
CATCGACATTCCTGTGCTGGACATTCACGGaaagcaaaaacaaaacaagcGCACGACGACGTTCTTCCAGTTCTGTAACGCCAAGACAGGTATCTTGCTC
TGTACGGACGTGGCAGCGCGTGGTCTTGATATTCCAGCTGTGGACTGGATTATTCAGTTCGACCCACCTGATGACCCGCGCGAGTACATTCACCGTGTGG
GTCGTACTGCTCGTGGAGCTAAGGGCAAGGGTAAGGCACTTCTTATGCTTCTGCCTGATGAGCTTGGCTTCCTGAAGTACCTAAAGGCTTCAAAGGTGGC
GCTTAACGAG