Description :
From Genome Similarity Track
Location :
Scaffold_1799:143- 1236
Sequence
1093 bases(100 bases per row)
TTCAACCGCGACAACCGACGCCCACAGTACGGACCATGCGCGGTGTGCGGTGGCATGAGTCACTCCGCCCACTACTGTAACAAGCGATGCAAGTTCTGCA
AACAACTCCACGATGCTGGACAATGCGAACTTTTCCGCAACTTCCAAGACCTTGCCAAATTTGTGCGCACCAAAGGCACGAAGGAGGAACTCCCGCCAGA
GCTCAAGGCCGTCGTTCAAGAACGTCATTTAAACTAGGCAGCCCGCCAACTACAACTGGGTTGGTCCCTATCGGGCTGCCACAGTTAACCGAGCCTTCAA
TGGAAGCAGAGTGTATCTTTGCTTTCATGGGGCAGAGTGAATGGCCTGATAAATACGTAACAAGTGTGAACGCGACGGAAAATGAAAAGGAGAGGAGTAG
AATCCTCGGTGGAGGTGTTGGAGAAATAATGGAGTGTGCTGATGCTGATGAGGGCACCAGCGAGGGTTCGCTCGGCTTGGTTTCGAGTGCAGCGCGAGAC
GAGCCCAAGGGTCACTCCAAGATTATGAAGTTGAACCCTGGCGAGAGACAGGGGTGGTGGTCGGCCAAGAAATTCGACCGACGAATCAGAATGAGAGCTC
TGGTGCAAGCGCTGTGAATGACCAGCGAACGAGGATCCTCCTCGACACAGGAGCAAACGTTAGTGTGATCACTGACGCCTTTGCCAAGAAGTTGCGACTC
CGAGATGTACCTGATCACGGACGCCGCATTGACATTCAAGGAATCAACGAAGGCAAGGTGTCTACGACGCGACGAGCGTGCGTCAAGATTACGCTTGGAT
GGGAGATGGTGTACGAGTTCGAGATGTGGGTAATGGCGCATAGTGCAGGCGTCGACGCAGTACTCGGGACCGACTTTATGATCCCAGCTGGGATCCGGTT
GAACCTGTTTCACGGCGCGGCGCAATTACCGCACGAAGTTCAAATCCCGCTGATTAAGACCAAGAACATGATCGACAACGAAGAATACGGCTCCCATGTT
AACGCCGGGCCACCCGAGCGTTTGGACATTCAAGCGCACGAGTGGCGAGAATACCGACTAGCGAAGCGCCACGTCGGTCTGGAGGAACACGTA