Description :
From Genome Similarity Track
Location :
Scaffold_6:1429861- 1437547
Transcript NameFunction/comments
Phyin_T30-4PITG_04590Putative uncharacterized protein
Phyin_T30-4PITG_04591Protein kinase

Sequence
7686 bases(100 bases per row)
AAACGAAAGAGCAATCAAAAGCTGCAAGCTCAACCTCGCAAATCGGTTAAGCAACTGAAAGCTGATACTGTTTGTGTCAATTGCAAAGCGAAGGGACATT
GGTATGGAGATCCGCAGTGTCCTGTACCTATGACACCGGAGCAAACGGCAGCCCGTGCAAAACGCGAAAGCATTGAGAAGAAACGTCGTACAGAAAAGAA
CGTTCGCTCGTTTGCTGGAGCTGCACTTGTAAGTGACCGTGCGACTGTTGAGCGTGCGGATGAAGACGAAGATAAGATGACAGTTCCGCCTGCTGCCGAA
TCGACTCCTACTATTGGCCCGCTGCCAGTGGGGGGGCTTTCGTCTACAAGTAATGCTGTACCGTCACGTGATCGATGCGTAGAACTTGTGCAAGAACCAG
CTAGAGCTGCGTCTGCTGCTGCTCAGCAGAATGCTGCTACTAGTATCGCGCCAGTGCACGTGGGTGGTTGCGCCGCTACACCCGTGACACTTATGCAATC
CTCGGGGACTGTGTGCGCTGTGCAGTCCGAAGATGTGATAAATCGTGCGGAGATTATCAATGCTGTTGGATCGCGTTTGGTGGACATGTATTCCTCGACA
CAGCCAGGCTGGGAGACGATGACTAATGCTATGGTAGAGAAGGTGTTTGGGAAGTTTGCAGTAGATGCAATTACTGCAGACCGTCGTAAGCAAATTGATG
GGCCGTGGTCACCGACATCTCCACCATCGTCGCCCGTGCTACGACAAGGGCAACGCCAAGTCGGATACCTTTCCAGTTACCATGTATCGCAGCAAACGCA
GCGTCAGCCTCTGGACGAGCAACAGCAATATGACCGCCGTAGTGCACCTCGAGGCAACGATCGTGGAAGGTCAACAGAGCAGCATCTCCCATCGCCACGA
GCCGGTAACTGGAGACGCAACCAATCACCGCGACTAGATGATCGGAGCCAATCGCCATGGCGTAGTCACCGTAGCCCGTCACCACGTCGCCCGGAAGGTG
GATATGGCTACAATTCGAGGTGGCGTGAGCCAAGTCCCCCGCGCTACAACTGTACCTATGGGCCAGGGTACCGGTCCGCCTTTGCTATAGGCTCCTCGGG
GCCAGGACTAAATATTCCTACTGGTGAACTGGAGTGGATTCTGGACTCCGGCTCACAAGTGAACATATGTGTGGATCTATCGCTATTTGTGAGCTTCCTG
GAAGCTACTAATTTGCCGCAACTACTATTCGCCAATGGAACAGTCGAAAGTCCTAGCGTGCATGGGTCGGTGCTGTTTCGTACGATGAACCATGCTACTT
CGTGTGTTGAAGATCGACTGCTCGATGATGTGATCTACTCTGCCAAGGCATCTACCAATATTTTAAGCCAGGGCTATATGCAGGAGCTCGGCTATGAGCT
ATCGTACACTGGTCCAGGCCAGTGTGTTGCGCTGTTGACGAAGGGCGACACGAAACTGCGTTTCGAGCGCATTGACAAGATCTACCGCTTACGCATGAAG
AAACCTGACTGTCGCAAAGTCATGACCGTTGCTGGTGCCAAGAATTGTGAGAATCCGATGAAGTTACTGCATAACCGACTCGGACATCTCAACATGCATA
CCATCAAGAAGATGGTGATCGATGGGGCGAATTTTGGGGTTAAGATCAATGCTACGCAGCTGAGCCTTTATGATTGTGTTGCCTGTCTTTCTGCTAAGTC
GCGGAGGATGACCTACGCTAGGGAGCCCGAGCGCGCTACTGCCACACTCGAGAAACTATCGATGGACATTTGCACTATAAACGAGGAGACCGTTGACAGC
AAGACTATGTTTCTATTTGTCGTGGATGAGTTCACGCGCTATAAGTGGGCCTTTCTACTTTCAAAAAAGAGTGATGCTGCCGCGCTTGTGATCGTTCTGA
TTCGCCGACTACACTCGCAGTTTACTAAAAAAACTGCCGTGTTGCAGTGCTCCATTCGGACCAAGGTGGCGAATTTCTGAGTAATGAGCTGAGATTATTC
TGTGAAGCTGAAGGAATCTCGCAACGGACTACCAACGCGTATTCCCCTCAAGAAAACGGGATTGTAGAGCGTGCAAATGGAACAGTACTACCGCGTATTC
GAGCTGCTCTCGACGCTACGGGCCTCCCCGTTATGCTATGGGGTGAGGCGCTCCTGCACGTGGTGGATACGCTGAACAGATTGCCTACGAAGCCGCTGGG
AGCACTCTCACCGCATAAGAAACTCTATGCAATCAAGCCAAATCTTGCTGAGCTACGGACTTGGGGGTGCCTAGTGCGCGCGCATATTGCGGCTGAATTT
CGTACACGCAAGGAGAAGTTGAACCCGCGTGCTGTAATGGGCCTACTGCTTCGTTATAGTGTGGAGACAAAGGGGTACAAGTTTATGGAGTTGCAGGAAG
GCAAGATCAATACTCACAGATGTGAGCACTTGCAATTTCATGAAGGCTACTCTGTGGATGCAAACTACATTGAAAGCCTATTGCTGAATGCCTACCGCGA
GGGCTCACATGATATGCCATATACCATTCCAGTGGTAAGAATCCGCATGGACCTGGACTCGCTTCTGACCAAGCGAATCAGATTGCAGCAGATACGGGAA
AGACTGTGGAGATCGTGCCTTCAAGCGCAGTGGAGGTAAATACACAATCACCAGAGAAAGCTGTACAACATCCTGTGTCGCCGAACGAGCTTACGCCGCC
AGATCAATTAAGTCAGAATAGTCTTGCTACGCACCGGAAACGCCGACGTAAAGGGGCCAAACGCACAGTTCGTGCGTCGACATCATCAGAGGAGGAAGAG
ACACTCTCGATTGTTGCTCCACAAGCTGCACCTTGTACTGTTCGACCTCGTCGTGCGACGAAACCGAACGTCCGTCTTCGCGATTATGTGGTTAATCACG
TTAGACTACATGCGTCAAAGGTGATCGTGCCAAACACCTACAAGCAGGCGCGGGCCAGTCCTTACTCGGGCGAGTGGGAGAAAGCCATGCAGGCCGAACT
GCATTCCCTGCGCGAGCATAACACGTGGAAATTGGTTCGACGCGAGCACGCTAAAGGACATCGAGTGATCACGTGCAGATGGGTTTTTGCTGTCAAGCGC
GACGAGCGAGGATTCGTCAAACGCTTTAAAGCACGCTTAGTTATTCATGGGTTCAAGCAAGTCGCAGGTGTGAATTACACTGAAACATACGCGCCCGTGA
TTCGATTTGAAACTATCCGAGCCGCGCTCTACTACGCGTTGCAGCGTGGGTGGGTCGTATTGCAGTACGACGTCAAGACTGCATTCTTGTACGGTGCGCT
CGAGGAGACGATCTTTATGGAACAACCGCAAGGGTTCCAGATGCAAGGATCTGAGTATATCTGCAATCTGCTCAAGTCGCTGTACGGTCTCAAACAAGCA
CCAAACATTTGGAACCGTACTCTGCATTAGAAGCTTATTGCAATTGGCTTTGAGCGGCTGGACTCTGACTATGGTTTATATGCTAAGCGCATGAATGGTG
AGACTGTGCAGCTTCTTACTGTCTACGTTGATGATCTGCTGATTATGGGCCTTCCACCTACCTGTGAAGTGACTGCACGTCAACTACAGGAGTCATTTGA
GCTGACAACCATTGGGCAAGTGAAGTATCTGCTGGGTGTGGAGATTTTGATCGACCGATCGCGAAACCAAGTGATTTTCTCTCAGCATCAGTACATCATC
AAGATACTCAAGCGCTTTAATATGCAAGATTGCAACGGATGCCGCACACCAGAGGCGACTACTGACCTTGCTATCAAGCAACCACTGAAAGAGGAGACGT
TGCCGTACCGAGAGTTGGTGGGTGCTTTGCAGTACCCTCGCGGCCTGACATTGCACATGCTGTGCGCACGCTTGGTACGCATCTTGCTAATTTCGACCAC
ACGCATTATGCCAACGCTAAGCGAGTGCTTCGCTTCTTGCAAACTACCAAAGATTACGGCCTTGCCATGTACATCTTGCCGAAGTCCGACGTCATGGTGT
CGGCGTATACTGATGCGGATTATGCAAATGATCCAGTGGATCGACTTAGCGTCAGTGGCTATATTACGGTGCTCGATGGAAACGTGATTTCTTACGCATC
TCGCAAGCAAGCTATTAACGCTCAATCAACTACCGAAGCCGAGTATGTTGCAATGTGCGAAGGAACCAAGGACATCTTGTGGCTCGTTGGTTTGTGCGCT
GAGCTGCAGTGGAAACACGCGACTCCACTGTTATTGGGAGACAACAAGGGAAGCATTTATCTGTCCGAAAAACCCACAGCAAGACGAAGCATATCGAGAA
TCGCTATCACCTTGTGCGTCACTGTGTGGAAGACAAACGTATCATGACGAGACATATTAGAACGGACGACATAATTGCCGATTGTATGACGAAACCGCTT
GGTCATGTAAAATTTGCGAAGTTCCAATCGCTGATGAAAGTTCTCAAAGTTGTGCAAGGACGAGTTGCTACCGCTGAGAGCTTATCTCCATAATGATAGG
ACTTCGTGGAGCGAGTGGGAGGCACACGATACTACTGCTATTATTGCCATTACTGCTTCTACTACTGATACAATCCATCTATCGCTGCTGAATGGAACTA
CCGCGATTTTTGCACCACTGCTCACGAGCGCTATTGAATTCGCTACCGCATTGCAGATCATTTTTTTTACAAGGTTGTGATCCTGCCGTTCGCGATCTTT
CAGCCGACTGTCGACAAGATCAAGTGGGAGTGTGAGATGGAGTGACGGCGGGCAAGATGGATACTGTGCGAGAGTGTCTATGTCCGCCCCATCGTTGGAT
TCTTCAACAGTCAACCCACTGCTAAAGTTGCTGTAAGCTGCCTGAAGCGTTGGTTGGCTGTGAAGTGCTGCTGAACATTTAGACTTAGTTTCACTATGCT
GTTCACTCTAACCTCTGCTTATACATTTGCTCGGATGGCGCTGCTGGCTCTCACTTTGCTATTTGCTGCACTTAGCCAACACGCCATCCTGTCGCGGCAC
TTTGCCCGGCAACTACGCGTTGTCTTCATCCAGTACCTTATCTCAGACTTCACTATCAACTACCATATTGGTAACCCTACGAAGTGGAGCTGCTACTAAG
GAAGCTGCCAGCGATAACAGCTCTCACCGTCCCTCTTGACCTTATAGACGTGGGCGAACCCTCCTTCCCCTAGAGCCCCCAGCACCTCGTACACTTTCCC
GTTCACGCGTGCAACGGCATTTCCCATCGTTTGCGCTCTTTTAGTAAATAATGGGTTTTACCGTAGTACCCGGGCTACTATTCTGAAGTGCCCTCTAAAA
ATCGATAATTTTTGAAGGGGGTCACCAAACGAGTAAGGACTTCAAAATATTGCTTATTGGACTCAGCGCAGCTTGGTATCCCTTTCGTGTAGTATTAATC
CAGTCTAGCACGTAATCTTCTTCCTGAAGGAGCTACAGTACATGTACATGTAGCGTTGCATCTGGTCGTCGTGGGTTCAAAATTGTAGACGTGTTGTTTT
GAAAATGTGCCTTGAAGAGCGAATTTTTATTTATTTGTAGACCGGATTTGTATTTATACTGGGTCTCAATTTGGTACAGGGCTTTTAAACTTTTGAGCAC
AAGTCAATTTTAGCACCCGGCTTTTAAAATATACAGGGCTTTTATACATTAGTTTTTTTCGCGGACTATTCTCATGATTTGCACCTGCAGAATGGTGGTT
ACGTGAGCGACTGCCTCCTCCTGTGTGTGTTTGTCTCTCTCTCTACTGATGCTGCTGACCATAGATCGCAGTCGTATGCCATGCTCAACGTCGTCGTGCG
CGACAAACTGGGCCAGGTGTTAGCTTGTGTGCTGGACAAGATGGCGACCAACGTACGTGGAGAGAGTAGATACTTGGATACAGAGCTGATGCTCATACTG
CTGTCAATGTAGGAAGTCGAGGTGTTCACTGCCGACGAAACGGACCAGCTGAGAGCGATGCTGATGCTATCGGACGTGCAGATCGACACGACGGTCGAAG
TGGCCAGGGAAATCTTCCGAGACGCGGCCACATTCGGCCATGTGGATCGCAATCTGCTGCTGTCGCGTGGAGTGGAGAACGACGTCGTGTCTTCCGTGGA
AAAGACGTGGAGAAAGAGAGGACGCTCACTAGCCACTCGGATTGCAGCGTTCCAGGGAGTAGAGACACCGGCGTTGACTCTCCAGAAGACCGACTGGCGT
CTGCACTTGGAAATGGGGAGCAGCAAACGCAGCGGACAGTCGCAGCCGACGGCCATTTTTCAGCTAGAATTGAAAAATACGAGCGCCGATGAGGTTTGGC
GCAAGGCTAGATTGCGTAGGAAGGCACACATTCTAACCCAGAGCTGCTCTGTTCTGCAGGTTGAAAAACTGGACGTGGAGCTATCGCACGCAGAGCTGCG
TACGCTATTTCTACAGCTCAATGCCATTCAGGCGGAGTTAGACGCGCCACCAACACCGTCCGCCGCGTAAGCTTACTAATAATATGCAGCAATAGCTACA
ACTGTACATTTCTACTAATGCCTTGCCCGGCAAGTTCTGGATAAATTCAAAGGCATTAATGACGTACTTCGTAGTATATTCCCAAGTTACCGTCCTGAAT
ACCAAAGTACAAAAGTAACCAATCCACCAATAGACTTGGCGTCAAAGCGTATTCCTTGGTATTCCTGAAGTTATGAGTGCAGTAGGAAGCAATCAGCTGC
AATAAATTGCAAGATCATAGTGCATCGCTCTCCGACAGCTCCACTTGCTTGTCTGACTGTGCAACCTCCACGGTCTGCAATCCAGGTATCGTCACGGCTT
CACTGGTAAAACTGGAGGCTTCTGTCTTGTCCTGCACTGCGTCTTCATTCTGCTTGATTTCCTTCAGTTGGGTTTCGTGCTCCTCAGCTTCCACTTCCAC
TTCGGGCTCATCAGTCATCTCTTCCAGCAGTGATGCCAGCATCAGGAACTCGGCCACCACTTCCTTCGGGGTCGTACTGACAGCATATTCGTACGCCTTC
TCATCCGATAGCAAACCAACTCGGTCAGCTGTAGCTTCGAGCAGATCGCCTCGTTGGAAGAACCTGTTAATCGTGTGCAAATCTCGTCGCAGCAAGTTCT
CTGTGTCAGGGTGTGAGCGATCAACGGCCTGACCGAAATCAATAAGCCAAATGCGCTTCTCGCGGTGGGCGAACAGGATGTTGTACTCGCTCAGGTCGCC
GTGAACCAAGTGCGCACGTTGGTACAGCGCTCGCGTGGCCTGCAGGATGTCAGCGTATGTACGAGCTTGTTGCTTGGGGGACAAGTCCGCCAGCACATCC
TTCAGTGTCGGCTCAGGCCAGCCATCGGCTCCCACAAACTGCATGACCAGCACATGTTCCTTGCTTACAATCGGAGTCGGGGCGCGGATGTTGCACTTGG
CAGCACGAGACAAGTTGCGGAACTCCTTATCCGTCCAGGCTTTGATCTGTCGCCGTTGGTCCTTCTTCTGGAAATTCAGATCGAAACGACGGTCTCCAGT
CACGTATTCGTGACGGTTGCCGAACTCGTTCAGCGTGGTGCGGAAGATCTTGACTGCCAGTTGTACTGGTCGCATCGTGGCTTCGTCTGTGCCCATAGCA
AAATACACATGAGCCTCTTTGCCGCTCTGCACGCAGCCGTGGACCTCGTCCAAATCTCCTTTGTTGATCATTTTCTGCAGAATCAA