Description :
From Genome Similarity Track
Location :
Scaffold_47:142968- 144212
Transcript NameFunction/comments
Phyci_482630ATP-binding Cassette (ABC) Superfamily

Sequence
1244 bases(100 bases per row)
CCGTGCGTGCTCAGCTGGAACAACCTCAGCTACTCGGTCGCGTGTGCGAAGACACCCGACGCTCCGGACggcaagaaaaccatcctggaccatgtcagcg
gccgatgcgcgcccggagagctcacggccatcatgggcccgtccggctcgggcaagaccacgctcgtggacctgctggccgaccgcatcagctccggaga
agtcacgggcgacatcgagctcaacggcgaggcccgcgtgaccaagacgttccgcgccgtgacgagctacgtggcccaggaggactcgctgctcgggtcc
ttcacggtgctggagaccatgcgcatggccgccaagctcagtctgcccaacagcgtctcgtccaagcagatcgaggcgcgcgtggacgacgtggtggagg
ccatggggctggccacgtgccgccacacgctggtgggcgacatcttccgcaagggcctgtcgggcggccagaagcgccgcctgagcattgccatcgagct
gctgtcgaacccgagcatcctcatcctggacgagcccacgagcggcctggactcgagcgccacgcacaacgtcatgaagttcatcgtgaagctctgcgcc
gagggcaagaccatcgtgtgcacgatccaccagccgtcgtcgctggtctacgacatgttcacgaacgtcatcgtgctgacggccggccaaacggtgtact
gcggtccccgggccaagaTGATCCCGCACTTCGCCTCGGCCGGCCACGACTGTCCGCAGTACATGAACCCGGCCGAGTACTTCATCAGTTTGGTGAACAC
GGACTTCGACGACCACGCGGACGTGCCCAAGCTGGTGAAGTCGTACGCGCAGAGCGAGATCCGCCGGGAGTTGGCCGCGAAGATCGAGGGCGACCGCAAG
ACGCTGCAGCACCTGCCGGACATCGAGCAGCCGTCGccgtcgtcgctgcgccagttcggcgtgctcatgtaccgcaacacgctcaacaacatccgcaacc
cgggcatctactggatccggctgttcatgtacttctgcctgagcttcatggtcggcaccatgtacctgagcacgaaccacaacctgacggacgaggacct
ggtgccgctgctgttctacgtgcaggcgttcctggtgttcatgtcggtggccgtgctgccgttcttcatcgagcagcgcgccgtgttcgcccgcgagcgc
gccaacagctcgctgagcgtcgtgagctacgtgtgcgccaactt