Description :
From Genome Similarity Track
Location :
Scaffold_27:142960- 145007
Transcript NameFunction/comments
Phypa_INRA-310PPTG_11533hypothetical protein

Sequence
2047 bases(100 bases per row)
GTAGTATTTCTGTTGCGAAGCACAGCAAAAACAAGAAAAAGCATGCTTCGAAGGTGGGCGTGTTTTGTCTTGTGAGGTGGTTCGAACGCTTTGCAGAGGA
GGTGGGGGAAGTTGTGCCAGTACGCGTCCGAATGCAGAAGACTGTGAATGGTACAACTCAAAAGTACTACAGCAGCGGAAAGTACACGCTGATACCGGCT
CACGTTATGTGGGACGCCATCCACGACGAGATGCATACATACATCGAGTCAGGACTCAGCGTTTACGAGCCCGCCCGTTCTACAATGCGGAAGCTTCTGA
CACTGCACTATCCCACGATCCGATTTCGCTCTCCCCGCAGTAATGTATGTGATATCTATTCCATTTACTACTCTGGTATGCGGGGCAATATCACGGCGGA
CAAGACCGAGGCGCTCGGACGTCACACCGAACCAGCTCGAAGAATGCGGTGAGTTGGTACTGGGATATGAGTAACATTTTGATTTACTCGGAACATTTGG
TCATGGGCATTGACAACATTTTGAATAATTGTTGAAGGGAGTACAAGCAAAACAAGGCTACGAGCACCGATGACATGCAGTTTTGGTGATGGACTACTCG
CAGAACTTGACGCTCCCGAGCGTTGCGAATACTCCATCGCAGTGGTACTTCTGCTCTCTTGTATCCGTGAGCTGCTTTGAAATCTACTACGAGAACGAGG
GCCTGCAGACAAACTACCTGTAGGATGAAAGAACTAGTGGAAAGGGTAGTGATCAGGTCAACTCAATGCTGGACGTTTTCATCGGAAAACTGGTGGATGC
TGGTAAGAAACGACTGACCCTCTAAGCCGACAAGTGCACTGGTCAATACAAGAACAATTACGTGGTGAAGTTTCTACTGGCACAGGTTGACATTTGTCGT
TTGCAGCACGTGGACTACAAATTCTTTGTTAAAGGCTACACGAAGAACTCGTGTGACCGTGATTTTGGCCACATTCGAAAGCAACAGGACTTGACATTTG
GACGATGGACCAGTTAGTCGAGGCTGCCAAGACGGCTGCGTCTAATGCAACTACTGTGTATGTGCCACATGGAGGTGACCTATTTAAAGGGTACAAGAAG
GAACTCACAGAGCTCTACAAAAGGCTGGACGGGATTCAGCAATACCAAATATTTTCTATGGACTCCAGCAAACCCGGTGTTGTGTGCTGCCGCATGAGCC
CTGAGTCGGAGGTTGTAGAGGTGGATTTGCGTCGTAAGTTCCACGGAGTATTGACACTACAGAAAAAAGGTCACTCGAATGCTGACCGAGCATCTTGAAA
GCTTGCCACCTCCCAACACTGAAAATATTGCCCAGATGTACCAATCTATTCGGCCCAACGTTCCTGATGTATTCCGCGACGACCCGCTGTACGAGAAGCC
GAGTGCCCGACAGGAAGAAAACGCGAAAGCCGCAAAGAAAGCGAGGCGTATACAATGTGCTGCAATGGCTGTAGCAGCCAAACGAAATTAAGATCAGCGC
AGAAGAGAGGGCGCAGATGACACTTCCGAGCCAATCTATGATGACGCATCAGGGCCTGTGAAGTCAAAAAAGGCCCCGACCGCCAAAACACCACGTCCGC
AACTAAGAAGCAAAAGAGTGCAGATTGATGATGATGTAGCTCCAGTATGAGCAGACGGTTGGTCAATGTTATTATGTTTAAAGAAAATCAAAATGTTACT
TATGATCAGAAGTCTAAATTTCAAAACAAAATCAAAATATACCCCTTAGGATTTGAATTCACTTTTTTTAATTGCTCTTTTCACAACGTTAGACTAAAAA
AATAGATCGAATGAATATCACCAATAGCTCAATTTTACGTCTAGATCAACAATAAAAAAATCTAGTTTTCTTGTCCAACATGGAGATAATTTCTTTGCCG
ACCTTGACCTCCGCGTCACCTCAACCAAATTAGACGTACGTGGGCTCAATAGATAGCTAAGACGTTCACCTATCGAGTAATAGTTTTAACTCGCGATTCG
TACATAGGTTCATTAGATATATTTTGTTTGACGCAGTCTCACATATG