Description :
From Genome Similarity Track
Location :
Scaffold_77:142934- 149999
Transcript NameFunction/comments
Phyin_T30-4PITG_18959Putative uncharacterized protein
Phyin_T30-4PITG_18960Putative uncharacterized protein
Phyin_T30-4PITG_18961Putative uncharacterized protein

Sequence
7065 bases(100 bases per row)
TTCTAACCACCGGATGCCGTCACTAATTTGTGATAATGACTCCTCGTCAGACCCCATCTCTCATTTCTGAGAAAGCACTTTACGACAGTCGCAAGATTTT
GCGAGAACCACTTCACCACAATCGCCTCCAGACCTGACTCATCGCATCCAGTGAGCTCACGTAGAAGTAAGCCGTTTTGGCGAAGCGATTCATGAACCAA
TCTGAGGAGCGACCTCAATTGAGGAAGCTCGTCAAGGTCACCTAGCGAATACCCGCTCTCGAAATAGCTCTTGAACACTCATCAGCGTTTCAAATTCTAC
CAGCACCGACTTGAAAGGGTCCAGTAAAGCTTGATGTTTGCGTGCGAGGTCGTCGGAAAGATCAGCGACGAGCTGATCCCATAGAACATGAACATTTGCT
GGGGCTGAATGCACCAGAATGGTGACAAAGAGCTGGTGTAGCTGAGTCGACATTTAGAGCTCAGCAGCTTCCGTCAAACAAGAAATCCACTCGCTGCCAT
TCTCCAAGTAGTCAACCTATCGAGCGGTAATATGGAATGTAGGACAACTCGTTAACCGCTCTCAAGTTTTCAGAAGACGTTGGGCCTCTACGCCGACAGT
CATTTTTACCAGAAAATGCCAGCAAAAAAGTCAGTTCTGACCCCACCGTTCACTCTAATTAGTCGGGCTTCGAAATTAATCGTGCAATCGCGCTTTAGTG
ACGTCACAAATCTGGGATATTTTAGAAGGCTCATCAATTCTAAACAAAGGCAACGGTTTTGGGCAGATCTCGGCAATTACTTTATTCTAGTGTGCTTGGT
TTGAAATACCGGTATGAGCTAGTAGTTTTAAATTACGGGCAGTTAAATTTCCAAAATTTTGTGCTCCAACCTAAACACCATAATTAGTCATGACTAATGG
ACGCGCCCTATTAGAGTCCGGACTATAGTTAATAGTGCCACCCGAAAGTGACAGAGAGGACTATAACCGGGTGAGGACTTTATTTCTTGCTGAAATGATT
CGTGTACCAGGTTAAAATCGTCTAACGCATCATCTTACTCTGAAAGATTTAACAGATCGACGTCTTCGTCCATATGCGGTTCCTTCGACCACTTTTCACG
AAATTTTGCGCCTTACACATCGTGCTTGGATATAAACCACGACGAGGGGTCTCTCGAGAAGCCTGCTATTTCAACGCTCCGCATGATTGTTGCCTCATCC
GTGTCTCGCCACGCGCGGAGGCCCCAATCGCAAACGGTGTCAACACTTGGCATACGTGGGTTACCAAAGCGAGTGTATTCGACTCGGTCTGACTCTTTCC
AAGCATTAATTTTCATGTACAGTAGGTCCTTGAAACGACATTTTTAATCCACTTGATCACCTCTTGCTTACGCCCAATGCTAACCGACTGCCTTTGATGA
GACATTATTGGAAATGACGGAAAAGTGTTTCTCTGTAGAATGGATGGTCAGCAAGTTTGTAATAGCAGATTTGGTAGTTTTTATCAGGACTCTATTCAGG
AGGGGCTAGTATTTAGTAGTGCAGGCATGTACATCTAGCACCCCACAGGACACTATTCGGTAGAGGGCTTTTATTCGGGCGCATCCATTAATTAGGTGTT
ATATACCAATTCACGACGCCCAATGAGAACTTGTGATTCGCAGAAAAAGCGCCACTTCAACTTGTGACTGTACCGGTATTCTTGGGTAGAAAGCCGCTCT
GGGCATTGATACATTTTGACCTACGAGCATGGGCAACTTCCTCGTGTCGTCGGTCTGTCGCGCGCACGGTCGCTCTGAGGCCGTGTACGCGATCGTGAGG
GCCCAAGTAGAGGCACTGCGAGGTCACCAGCGTCGCGGCTCGCCCTTGCAGCGACGGTGTGCGGCACAGCAAGCGGCGTTGCTTCGCGCACTCTCGTCCA
AAATGGCGCTTACCGCCGCCGTGATGAGTTGCTGGGTAACAGCCGCTACAAATCGTGCCAGGGCCGCTCTCGTTGCATCGCTCGTGTTTATCGCAAAAAA
GTTTATCGCGAGAACGAGCACACAGCGATCATTGCCGTCGCAGGTCTACGACGACGTATTTAACGAGTTCAACGCTGTCTTCGAGACAGCCCCGCAACCG
ACGAAGACACTGCGAGAGCTACATGTACAACACAGCGCCAAGCTGGACGCTGAGAGTCTCAAGGCAGAGGCCGAAGCACAACAAGGAGGGGTAACGCATC
GCGAGACACCAGAGTATAGTGACAACAATGCTGCAGACGACGAGGCGTCGTGTTACACGGACGGCACCAACCAGTTAAACGACTTTGACGACGAATACGA
GCTCCTGCCCAAGCCAGAGGAAGATCGCGCGTTCTATGCCGATCTTGAAGGAAACCAGGTGGAGAGCGACGCCAGCCAGACGGACTCCGTCACGGAGGGT
GAGCGACTGCTACAGCTTGCCTCGAGCATCTCCGACACATCGATGCGCGTTGAGGAGTTTATTATCAACGGGAAACACGACAATTTTGAGGTTATTACGA
AGGATGTGGATGATCACGCTGCAGAAGCCAATGAAAGCGAGAAAAGGAGCATCGTACGCGTGCTACTGGCGTACTGTGCCTACAGTGAAGACTCGAATTA
CTCGAGCGATATGGTCCTGACTGCCGAGGAGTGTTTGCAGGTGTGGCAGGGCGACGAAGATCGCGCTTTCAAGTCGCTCGCCGTCCTGTGTAACGACGTC
CCGCGTTTGTGTGCCGCTCTCGAGTGAGCCTCTCTGCCGCAGTCAAATTCCCTTCTACCGATTTTAGTTTATGAAGAAAATACTTGTTAAAAGCCGTTGA
GTTAGTACATTTGAACCGAGGTCGACCAGCTTAATTCCGAGAGGAAGCCGATGCCCGCTTCTTCGATGCTCGCTTGGCCGCCTTAAGCCGTTGTAGCTGA
GACCCGACGGGGTCGCCGAAGTGCTGGAACGAGTCCGCTCTCGCAGCAGTAGCAGCTGTACTTGAGCCACTCGAGTGTACTGGCCGATGGCGTCCACGCA
CGCGCTGCTTCTGCGGAATGCCTTTGAATACGACTACTCTCGACGCTAGCACGTCGTCTGGATGTACGTCCAGCAGCGGGATCCCGAGTCCTAATCTTTT
AGCCTCCTGTTTTCTTTTTTTGAGCTGCTTCTTGATGCTCCTAAACTGTGCTCTCAGTGCCGAGTTGCTGTCGTAGTCGTCTTTAAACTCTGCATCTTGC
AGCTCCACGAGGCGCTCAAGCCCGCGTGACCTCTTCTTGGCCGCTTGTTTGTCCTCATTTTCGTGCTCTAGTCGGAGAAACGGATCGTCCATCAACTTGG
TGCCCAGATCAGTGTCATTCAGGCGCTCTATCTGCCTCTCTTCAGTACTGCTGTGCGTCTCCGCTTTCTGCCTGACACCACTGACCATTTCGTACCCGCG
CTCCTGGGGGTCCGTCTTGATCACCATTTCGCCGCTACAACTAGCACAGCTCATGCGGAACTCCCACACGGCGGACGAGAAGTAATTTCCCACCCGCTTC
TTGCGCGCGTTGAAGCGGACACCCCGTCCAATGTGGGAATCGCAGTGCGTGCACCAGACGCTGAAGGGCATCTCAAAGCGCACCACCAGCACACCATCGC
TCGCCAGATTCTTAGCCCGCTTGCCCAGTGGGTGTGACCCATGGAACGAGTTGAGCGAGCCATGCTCGGGTCGCCACTCCGCCGGGTAGTAGTAGCCGTC
TGCTTGGGTTGCTGCAAGTGAAGACATCCTGTCTTTCGATTTTGTGCTGACCAAAAAGTCTGACTAAAAAAAGGTCCCATTTACAAAAAGTCGCAGACGA
CATTATCGAGCTCCCATTGTAGCATGACGCGCAGACGCCCCAAGACCACGACGCACGTCCATCGTGTCACCAAGACGACTGGTACTAAGTCGGGCCTGCT
GCAGCACCGCAATCGTCTACTGCGGCGCTCGTCGATCTCCATGCTCGCGCGCAAGAATCGGTAAATCTAGTGCATGTAGCTCCCCCCTCTCAATAGCGAT
CAAGTCGCGCGCCATTCTTTTTGCGTCTACTAACCAAGCTGTCCATCGTCTCTTTGTGTTGTAATGTGATATGGCAGCAACGACGACGAGAGTGACTATA
CACGCGCGATCAGCAGATTCGTACCCAGAGCAGAGCGGGGATCAGCTGCACAGGCGATCTCGACGGGCTCCACCAGCAGCAATAACAGTGTGACGATGCT
AAGCCCCAAAAGTTACACGCGCGTGGAGCTCATCAATTTCTGGAGGGAACTATCGCTTGTGGCTAAGCGGCGACTGCTGCGGATCCGCCGCGATACATTC
TTGTCGTCGCTTGACGAGTTCCTCGTTAGCTTTAACATGTGCTGCGAGTGCCACGACAATGTAATTGCAGAGTGGGAAGACCACGAACGGAAGCGCTCGG
GTAGCCGCTCCAAGCTGGACGCTTTCAGTGTCTTCCCGCCATTTTTGGGCGATGAGGAGGAGGAAAGCGACGTGGAAAACGAATGCGACGATGAAGATTG
CGACGATGAGGCAGAGTTGGAGGACGAGTCTGATGAGGATATGGAGGATCTGGTGCTCGAAGAGGAGGAACTGGTGTTTAGGTCTGAGCTGGAGCGGGAA
GGACGACGGGGCGCAGACGGCAAGGGTGGCATGCTGTCAGACGAGTATTTGGCCGCGTTGGAAGTCGGCAAGCGGCAGGAAGACGAGCTGCTACGGCTTA
TCCAGAAAGAGGAACGCTATATCATTATTCGGGAGGATCACACGGACTTTATCGAAGATATGATCCGCTGTGGCATACCGATCAGCGACGTGCAACCGCT
CCCACCCGGCTTTGACGACGACGAAAGCGAAAACAGCGAAGAGGACGACGAAGTTGATGTCGATGACACATGCCCCGGCGCGAACACTTCATATTGGGCC
CAGGAGTATCTGCTGGATGTACTCGGCATCACGTTCAGCCAACAGGTACTTTGTATGTTGCGTTGCTGTGTTACCTGCCCATGGAACTAACACTTGTATT
TTGCTGCACGGCAGCTGGAAGCCGCATACCAAGAGGCACTGCAACACTCGCTCGCTATTCAGGCTGAACTGCTACGAGATGAGCTTGCAGACCTTCAGGC
AAGTCAGAAACCCTCCAGTACCAGCCGGAAGAAGAAAAGCAAAAAGGAGAAGAAGCGCCGTAAAAAAGAAGCCGCAGCTCAGAAGGCGACAGAGAATGTG
AATCCTCGAGATACAAACACTCAGTCGCACATGTCGAAGCGCAACGCTGCCGCATCAGAGAAGCAGCAGTTTGCCTTAGCATCGACAGACGGAAGCGCCG
ACTCGGTCATGGAGGTGCGCGTCCCGGAGGAAGACGACATCGACCGTGAGGTGGAGCAGTTCCGTCTGTTGCTGGAGAAGATCAACGCCGAGAGCGCGCT
CCGCTCCCGAAAGAAGCTGGTGCTGCCTCCAGGGTCCTTCGCCCACTTGACGTCTATGACCGTCTCGTAAGAACTGGGCACAGGTTGTTGCTAGAGGCCC
TCTTGCTAGTTGAAGCGAGATTATAATTTCCAAAATCCCTATCCAGGTGTTCAAAAAATATTCCTAGAAAAGGGTACTATTAAAAGCAGTACAGTACAGT
AGCATTTTGAGGGTTGGCGCCAACTGTTCCAACTCGGCTGCCATCGCGCCAAAAGACCGTCTCGTTTCTGTCCGTCTGGTTTTCACTCTGGGCCGCCGAT
ACGTCAATCGGCAATTTGAAGTCGAGTGAACAGGTCGAGTGTCTAAAGCTGCCAACGAATGGCAAGACTGCGCTCTCAGCAACCAGCAGCGGCGTCTGAG
AGCCCGGATGCTGATGCTGAAGTCTGCGCCGTGTGCGAGGAGCCGTCACAGCGTGTGACCGTGAACTGTTCAACCTGCACGAAGCTTTTTCACCTGGGAT
GCCTCAAACCGCCGCTGCGTCGCCGGCCGCAGCTGGTAGACTCGTGGCAGTGCTCAGACTGTAAGGGAGGAGGCGAGGAGAAGAATGGACTTGTAAACAA
TGGCAAGAGAAAGAAGAGAGATACCCTAGTGGAGATGGAGGAGGCAGAGCAGCCGATGCCCAAGAGACGCCGAGGGTCGACGAGATCCACACAGAAGGAT
GAAGACGATGACTTGGACAAGAAGCCTATAGCTCAGACGCTGCTGAAGCGTCAGAACGGGAAGACTGCTATGAAGATGAAGGCGAAGACGTTGCCAAAGT
CACGAGTGGATGGTCGAACGGCTCGCCGTGCCTCGTCCCGAAAGCTGGCAGTTGTACTAAGTGACGACGATGAAGACAACGACGCTGACAGTGATTTCGT
TGGAGACAGCGTATGTGAGGAAGAAGACGATGACTTGGTATCGTCGGCTATATCGAGTGATGAAGAGGGGCGAAAACCGGTGAGAAGACGTCCGCCCATG
AAGAATTCTCCTCCAATACAACGCGCTGCGATAATTCGCCCTGCAACTGCCAATCTAAATATCGATGTCTCCTCCACCCGCATTACTAGTGCAGGCAACA
GTATTCATGGTAGCGACGTAGATTCGTTGGACATTGAAATTGTGGGCGAGAGCGAGGTTTCGGACGAGGAGGATCTGTACGATGGCCCCCACTACTTTGT
TGAATACGCAGCCAATGGCAGATCTAAGGTGCGTCGTTCTCAGTTGCGTTGCTGATGATGTGTTTCCGGTTCTTAACGCAGCTAATGCATGATAAAAATG
CAGTGCAAGAGCTGCGAGCAGAAGCTTCTCGTCAAGCAGCTTCGTGTAGGTATCGACATTCGACACTCAATTTTCGGTGACACCACTTATTACAAAGTAA
GTGACCCTAATCTCGTGGAGTAAATGTATTTGTCTAATGGTTCTTGGTCTCCTAAATACCTAGCATGTGGAGTGCACCATGATCGGACTGAAGGCTGGAA
CTACCGCCGATCTTACTACAGAGGAGGCAGATGGCAAAAAGGTGGACAATAAACTTGCGAAGAAGAAGAACAGCGATCCTATTGACGGATTTTCAAGGCT
GCAGGCTGCAGATCAGAAGCGTGTTCGTGAGTACATGAAGAAGAACGACATGGACGGTGTCATTG