Description :
From Genome Similarity Track
Location :
Scaffold_86:14291- 42585
Transcript NameFunction/comments
g7083.t1XP_009515600.1 hypothetical protein PHYSODRAFT_469283 [Phytophthora sojae
g7084.t1hypothetical protein
g7085.t1ETI40658.1 hypothetical protein F443_14022 [Phytophthora parasitica P1569
g7086.t1hypothetical protein
g7087.t1POM68524.1 Splicing factor U2af large subunit [Phytophthora palmivora var. palmivora
g7088.t1hypothetical protein
g7089.t1hypothetical protein
g7090.t1hypothetical protein
g7091.t1hypothetical protein
g7092.t1hypothetical protein
g7093.t1hypothetical protein
g7094.t1POM75984.1 Hypothetical protein PHPALM_6833 [Phytophthora palmivora var. palmivora
g7095.t1hypothetical protein

Sequence
28294 bases(100 bases per row)
TGCTGCAGAACGCAAATCGGCGAAAGAAGCTGATCAAGGCGCAAAGGGGGGCGTGGATCTATCAGATGATCTCAAGATGCTGAGCACGGAAAACGACAAT
CAGCACGGCGTAGATGCTACCGAAGATGATGATCTCATCCTCGATATTCCGCCATCTTGGGTGATCAAGCTTCATATCGACCGTGCGACGTACAAGAAGC
GTTTTGTGAAGGATTGTCAGCATGTTACGCTTTATCATTGCGCTAAAGTAGAGGAGTTTGCCGAGAACACACATGAGCAAGGCTTAATTGCGCGGGTTAC
TATCTTCCGCGACGTCGGATGCACTCTACCTTTTGAGATTCGCGAGTACTTCAAGAACAGGAAGGATCGACTCGAGTCCCGTACACGTTTTCCATTTGAA
GGCAAGTTTGAGGAGAGCTTTGTGCCGGGTCGGATTCCAGAGGCGTTGAAATCCCGTACCGAATGGATCGGATATCGCCGTGAATTGCAATTCTACACGA
GCGCTCGCCCCGACGGTTTAGTGAAACGCGAAGAGGAAATTCAAAAGCGCGTTGTGGAGCACTTCGACGGTCGCGACGACTTTCTTATCTTCAGATCCGT
GATACTCGCCACGGACAAGGACGAAGTAGACTCGAAAAATCCCTATGTGTTGCCTGGTGGTCCTGCTGGTGAAATTGCAATCAAGAAGATGAAGGAGAAG
TTTGCACGGAATTCTGCGCTGGTGGCTGATGAAGATCAGCGTAAGCGGGCGTACAACGTCCACGAAGGCTCCATCCGCGTCTACTTCCATTACGCGACCG
GAAAGATTACAGCAGGCTCGCGTGTGTATTTCAAGGCTCCAAACGTTCCTGTTGAGGTCGTAATGGCAGATCCAACCGCGAAGAAGCCGAAGCTATCCGT
ACTGGAAAATGAGCTTCGAGCGTCTCTGCAGGTACTTTTGCGTTAATTTACTGTGCGAGCTGCTTGTTGATAATCGTGGGTTGCTTGCTGCATGTTTAGA
TGGAGAAGGACTGCTACAGCGCGGTGCGTCATTCGGACATTGAAACGCAGGACATCCTGAAGATCCGAAAGCGTGAGGAAATGGCGATTGCCTTAGAGAT
CAGCTTCTTTGACAGTAACGAGGACGAGGCGCAAGCAAAAGACAAGGAGGATGCCAAGGAACTCGACAAAAGCGTACGCTGTGTTCGTTCTCCACTCACC
GCGTTATTCACCACCTCACCTTCTTCAAATTGGCAGGCAAAGAACGAAGTGGACTATCTCAGTCCATTCTTGCAGAGCATTCACGCGTCCGGTGATCTCT
CCAAGGAGGACGCTCAGACCGTGCGCGATATGTGTCTGCGCAACCTGAAGGAACGGCTGCTGGAGCGTGCGAATATCATCCAAGGACGCCTCGATAAGGA
GAACACGCTGCTCGCCAAGCGCCAAGCTGCCTTCCAGCGCAGTCAGCGAGAGCACGACCAGGGCACCGACGAGGAGTTCGAGCGTTTCTGCAGCGAGACC
ATGTTTCGCATCCAGATTTTGGAGCAGCGACTGGCAAGTCACGAGGAGACGGCGCTGCAGAAGTACGCCGAGATGGATAAGCGTCTGCACGGTGACCCTC
GACTGCGTGTACTGCACCGATAGAGGACGAAGCAAAGCACGCACAAACCGAATGAAGACCGGGCTTGAGCATGTGTTGAGGTAGCAGTAGTTCCTTGTGG
AAGCTCTTCGTTTTATTCGCGTTTTACAGGGGAGGCAGGGAAGCACAGCAAGTCCTTACACTATAAAGAGACCTAACAGAGTCTTCCCACGCTTCTCGCT
CCGATGCTCAGCCGCGAACGTTCCGAGTAGCTGATTCACAAATCCCCGACGGAAGCTGATAAACCCCTTGCACCAAGATACAAAAAATGGTGCAACGGAC
TCTAAAGCATGGTAGTCTCCGAGCAGCTCAATGCGTCAATTGACACACTTGAGTTATGCACGAAAGAGGCAGAAGACGACGCTTAGTAGTCCTCGTCTCC
GCCGAACATGTCCATGCCGCCGCCCATGTCGACTTCCTCCTCCTCCTCAACGGCCTTCTCCTCCACCTTGGCGGCAGCCTCGCCACCGGCGGCAGCCGCA
CCCGCAGCAGGGGCGCCACCTGCAATGCATCAGCATCTCAAACAGTTAGCATTGACTATTGAAGGTCCGATTATTAAATGATAGAGGGAGAACGCACCAG
CCGAAGGACCAGCGAGGAACTTCTCGACGTCCAGGCCACGGGCCAGCAGGTCGGCGAAGAGCGGCGCCACGTAGGCGGCCACGTCGTTGCCCGAGGCCGC
GAAGGTCTTGGACAGAGCGTCAGCCGTCACCTCGACGCCGGCGTCGTAGAGCGCCAGGATGGCCAGGGAGGCGGCGAACTCGTCGCGCTGGGTCTTGCTG
AGATCGGCGAAGGACATGGTGCGTCAGGAAAGATAGAACTGAATCGGTTTAAGCTCGGGAGCGGAAGTCAGTCTGCCAACGAACGGATGCCGCAAATGGC
CGCGAATGACTGGTCCTCCTATATTGCAGGATATTGGCCAATAGCAAGGGAGCAGTGTGTACATTACACCACTCGCAATCATATAACGGCTTTTCAGCCA
ATCGTGCAACGCGGTTTGTTCAGCATTAAAATGGTGGACGCGTACTGTGGCGCCTGCTTTCCTCGGCGCAGACACTCAAGCCGCAGGTGGCGGTCTACGA
CCTGGTGGTGATCGGCAGCGGTCCGTCCGCCACGCAGTGCGCGCTCGAGTCGGCCAAGCAGGGCAAGCACGTCTCGTCTTGACTAGCCGCGCTGTTAGTC
TCCAGATGACATGGAAACATCGGCATTCAGACTTTTCCATCTGCGGCGACATTCCATTCCTAGGATAGGGCATGTGCTTGCGCTTGCAAAGTTCAGGTGG
TTGCCGTGCGAGCTCTCCCAAATCTACTTGAATTGCCCAGATGGCAGCAAACGTAGAGATACGCAGAGCTATTACCCAAGGCGTGTGCTTTTTCCATCGA
GGTCACGCATTTGCCATATTTCTCGGCATCAAGCACACCCTCCGCCGATGGTAGCTATACGACAGCAAGAAGACGTCGCTGTCGTGTTTTCGTCAGGCGC
TTCACTGGCTGAGAGCTACCACCGCTCCAACGACAATTACAACCGTTCTGCACCAACCACACCGAGTGGCTTTGGCAAGCGTACTATCGTCAGCAAACGC
GTACGTGAGCTCGCTGACATCCCACGAGCCGCGGGTCTACGAGATGTCTCCGTCGACGTCTCAGTCGCGCACACGAAAAGCAAACTACGCGCTCGCTTTT
TCGTCGAGATGAAGCGCGAGAAAACAATGCCTTGTCAGAGCTGGGGATTCGGTGTGGCGCTATTGGACATTCGAAAGTTTGAGCTGCAAATGCATCAACT
GGTGAAGAAACGCTACCGAGCTAACCGCCAGGGAGAACGCAATGGAGTGAAGAAGTGCTGCGCAATGTGCATACAGCTCAAGGATGACATGCGCGCGTGG
TCTGCCGTCAAGCGCTGGAGCGCGATCAACCCAGGACACAAAGAGCGGAAGTGTGATACCATCAAGCTTTTCTTCGAGAAGCTCTTTGAAATGCTGAGCA
ATCACGCGCAGTGGATGCACGAATGTGAAGCTCTCCGCGAGATTCTACGCGCGACCGAGGAGCTGACTGAAATGCAGTACCCGCATGACGGCGATGCAGT
AGACGTGATTCGTTCTCTACGCCGTGTTGATAGCAACGACGGGGGGCATGCGAGCACTGACACGAACTGCACTATTTGCATGTCAAACATGAACACGTTT
CCGGAGGAGTCGGCAGACCGCGGGCGAGCATGCGGTGTTGACCTACCGTGTGGGCATCGCTTCCACGACACGTGCATTTGCATGTGGCTTCACGCGCGTT
TAGACTGCCCCGTGTGCCGCGGGCATATCTCCGCCCCCCATTCTGCGCTCTCATCGTCGCGCCGAATCTCGTAAGCAAAGTGCGCACATGATATTGACAT
TCACATTGTTTTTTTACGCGATGGCTGGGTGACTTCCAAAAGTGTCTCGGTAGTGATAGATCTGTGAATATATCAACAGAAACATTGGGCTGGGCACAAA
ACATGGAGTATTGCTGCGTCTTCTGCATAAACCATTCGTGAGCAGGTAGCTATGTAGCTGCCCTATTGTACTACTCCAATAAGTGGATAGCTTTTGTGTT
GTTCCGAAGCTCCGCGAAATGTAGAGCGTTTTCTCCGAACTGTTACAAGCAAGGTGGCGTTAACAGCAAAAATGTGTGAGACTAGATGCACCATGCCACT
TTGTTAGATAAGTATGAAATGTACATGAGTACCAAGTTCTGGAGAGTGATGTCGGCTCCGTGCTTACGAAGAAAATCAATTGCCTCTGTTTGGTTCGTTT
TGGCAGCAACTATCAACGACGAATGTCCCTGTTCATCAGTAGCGTTAACGTCGGATCCAGCCTCGACCAGGAGCTGAACCACCTCCAGATTCGCTTGTTC
ACTGTAGCATGCGTGGTGCAGAGCAGTGGAACCATTCTGTATCACCGACAACAAAGTAGCACGATTATTAGCACGCGTTATGGATAAAACACAAACTTAA
TGAGGTACTTCGTAATACATGCCGTACAGAGCTGGAACTTACGACATTCTTGATAGAGGTCTTCGCACCGGCCTGGATTAAATGAGTGACGCATCCTGGG
CTTCCTGCTCGAGATGCATTGTGCAGTGGTGTGTTTCCAAACTAGATAGCCTTGATGTTAGAAAAATAGAAACGATATGGTTCACCCAGCAACAAAAACA
ACATGAATCGCTCGTTACCTGGTTCTGCAAGTTGATCAGCTGAGCAGACTCCTCACTTGGTCTCTCGAGAACTCTGCTCAGGACAAGTTGCAAAATGGTC
GGATCTCCTCTGAAAGCAGCCTCGTGGAGAGGGCTATTGCGGTCCTGTATGCAATTGCGCAGCAGTTAGCACGACACTACATGTCCACGTAGACGCAGAC
AGCATTAAACGTACGGGGGTCTTCAGCACTCCCAATTCCGCTCCAGCGGTCAGCAGAATTTGAACGATCTCTTGGTGGCCACTAGAAATGGCAGCAAGCA
GTGGCGTGGCTCCATACTGCATATTCATCAAAGTTTAAAGCACAACACCGCGTTCTTGGAAATACTAAATCTCGTACCGACAGCGAGCAGTGCCAGTTGA
TGTCCACTTGAGCGTCCTGCACAAGGTCTGTCACCACCTGGGTATCACCATTCTCGCTGGCGCGGAACAGCTCCTCTGTCTGTCTGGAAACCACTCGGTT
CGCACTCATCGTCCTCAGCTAGTGACTCTTGGAAAGCAAGATCCAGCAATTGATATGCACCATGAAAGGTCGCTCAACTTGCTGCTGCTGGTAGTTGCCA
GCATGACATGTATTTATCTACTGTCCTGACAGTTTTATGACGGGAATTGACCAGTAGACATGGCCTTTGTACGATGGCGTCCACCATTTCCGAATTGTCG
CGCGACTCCACGATGCCGACTCGAGTCCTGATAGCGCTGCTGGTCATGGCGACAGCTACGCACGTCGCTGGAACTTGCGATGGCTTCAACCAGCTGCGAA
TGTTCCTGAACATGAACCAAGGCGGCGTTGCAGACTCGCTCCGGGACTGCGTGGCGCCGCTGCTCTTCGCTCCCACCAAGTGGCTCCTGACGGACCAAGC
GAGTGAGTTCTGCAGCCAAGAAGTCTGTGTACGCGCTGTGGCGCAGCTCAAGAAGATGCCTGCCTGCACGTGGGACAGTCAGGTGCCGTCCGGCAGTGAC
GCCAACACGCTGGCCATCGCGCAGCAGGTCATGCGCGACTGTGGCGGCGCGTAAGCAGCGGCTTCAACTTGCGAGATTTGATCCCTCTTTAAGCTGTTAA
TCGAATTTCATGATGTAAACTGTGTGCAACAGTGTCTGTATAATGTTCAAGATTTATTACACAGCCAGATAGAAAAGACAACCTCTTTATTCCACTAACT
GGTGTACAACATACGACTAAAGTACCGCGGGGCGGCCAGTGGTGGACAAGCAGTAGATCGAGACACTGAGAGCAGCACTATGGCCGGGCGCGGACGAGAG
CTCACGCTGCCCGCGTGGATGAAGAACCAACAGCAGCAGCAACAAGCAGGAGGCCCCGCGCAACCCCCGCCACCGTCCCGCAGCAGCGCGTACCCTCCCC
CTCCCGCGCATCTCCAGATGCCGCCGCCAGCGCCGGCGCAGTTCGCCAACGCACCGGTACAATTTTATACAATTTCCTTTTGTTGTTTATTATTTACACT
TGAACTTATATAACATTTGCATTGTTGCAGGAGCCTTCGAACGGCGGCCGACCGCCTGTGAACGCGGGTGACGACCGCCGCCGCGGCTCGCACCGCAGCA
GTCGCCGCAGTCGCAGTCGCTCCACGCACCGCCGGGACCGCAGCCGCAGTCGGGAACGCCGCTCATCCCGCCATCGCTCGTCCCGAGACCACCGCAGCCG
CAGCCGAGACCGCGAACGCCGTTCGTCCGGGGAACGTTCGGAGCGCCGCGCGTCCAGACGCAGTCGCTCGCGCTCGTCGTCGCGTATTGTTCGGCGCCGC
AAGAAATCCAACTTTGACGTGCGGCCGCCTGGCGTCACGGAGGAGAACGCCGCTGCTTATGCGGCGCAGGCCATTCTGCAGCAGAACATGGCGGCGCTGT
CCGGCTCAGTCGGCCCGGCGTCGTTTGGTCCGCCGCAGACTTCATCGCCGTCGATGTCCACCGGGGTGAGTCATCGTTTGATCAACTTTTTGCCTCGAAT
CGAGGACAGCAACCAACAGCACGGAGAGATGCAACGGCTGACACGAAATCTGTGTTTTCGTTGTCCGTTGTCTGTCCGTTGTGGTACTTGCCTGGCAGCT
TTGCTACGCTTTCTGAGCGGTGCTGGATTCGATCATGCTAACCCTCGCATCTCCGCTAACCTGATTTTATGTGTGACTCACTTGTTCAGAATGCCCCACC
GGCTCCGATGTACAACCATTCGCACCAGGCTAGCACAGGATATGGGTTCCCTGGGCAGTCGCAGCAAACGCGGCACGCACGCCGACTGTATGTCGGTGGC
ATCGGCGAAATTGCCGAGCCGGAGATCACCGCGTTCTTTAATGATGTCATTGACCGTGCGCTGGGTGAGAAGCAGGAAGGCGGCTCTGTGGTGTCTGTCT
ACATCAACCGCGAGCGTCACTTTGCCTTCGTTGAGCTGCGCACCATTGAACTTACGACTGCCTGCATGAACCTTGACGGTGTGGCTTACAACGGCCAGCC
TTTGAAGATTCGTCGTCCTAACGACTACAACCCGGCTACTGTTCCTAAGGACTTGGGGCCGATCCCACAACTCAATCTGGCGGCGCTGGGCATCGTGTCG
ACGACTGTGAGCGATGGCCCGGGTAAGATTTTCATCGGTGGTTTGCCGTACCACCTCAATGAAGAGCAGGTGAAGGAGTTGCTGCAAGCGTTTGGCCCGC
TGCGCTCATTCCACCTTGTCAAGGAGGTCAGCTCTAACCTATCGAAGGGCTACGGATTCTGCGAATACATGGACATTAATGTGACGGATGCTGCATGCAT
CGGACTAAATGACATGCGACTCGGCGACAAGACGTTAACCGTGCGCCGCGCGATGTCACAGGAGAACGCGAAGGCCGTGGCGAGCGCAGCAGGTACAGTG
AACACGGGCTTGGAAATGGGTCTAGATCCCTCGCGCGCTGCAATGCAGGCAATGAGTTTGGCAGGCATCCCGAGTGTGCCCCTTGGCACTCCGTCTCGTG
TGATTGTGCTGCTCAACATGGTTACTCCGGAAGAGCTGGAGGACGAGGAGGAGTATGCTGATATCTTGGATGACATAAAGGGCGAGTGCGAGCGTTTTGG
CGCTGTTCCCTCACTGCTTCTGCCACGCCCGCGTGACGGCATTCCCAGTGCTGTCGGCAAGGTCTTTGTTGAGTTCGGCGAAGTGCAGTCAGCACAGAGC
GCGGCAACGGAACTTCACGGCCGCGGGTTCTCTAACAGAACTGTGGCTGTCGAGTATATGGACGAGGGCAAGTATGCGCGCCGGGAGCTTGCTTAGCCAA
GTGTATTGGTGTCGCTCAGTCGACAGCACGTTGCTACTGAAGATTAAGAAGCGTGAAACGATGCAGCTGAAGAAAAGATGTTGACTGTTTGCTCAGGTCG
TGGACGGGCCCAGCATCATTGTGCGAGATCTTTGGCATCCTACAGGGAAGTATGTACGTGCTGCATGTGACTGCTTCGTGTGCTATGTGCTTTTGCACAA
GCACTTCCTGCATTCTACCTTCATAATAAATTCACGTGTCTTCTTCATTTTGCTTCGTATCTTCGGACAGCTGTATGCACACAAATATGAGGAGCCGTTC
ACAGCTCCAGTCAAGACTTATTGTGCTTCATTCAGTATGAATTGCTCGGCTAGTGAGTAGCCGAGCTCCGTGGCCTTCAAACGGTCAACGTGCAGAGTAT
GGTGAGTTCGATCTAATCGCAGGCCAGCCTGATCTTTCGCGACGACGCACCTTCCGAAAATGGGCTTGGGCAGCATCCGCGTTGCGTGGAACGCCTTTGC
CATGCGATAACAAGCATCCCAAATTGAAGTGCGCGTGTGGGCTATCCAGATTCGCGGCACTGCGGTAGCACTCAGCAGCTTTCACGAAATTCAGGTCGCA
GCCATCGCCTTCTTCGTACATCAACCCTGCATCCGTCGGTCAAGTTTGCAATGGTGAACGACATAACACAGTGAACGGAGGACAGTTGCCGTACCTAAAG
AGTTCAAGGCTTCTGCGTCTCCTGCATGTGCTGCTATTGCGTAAAAGCGTTGGGCCTTTGACTTGTCGATGGAGCAACCAATGCCTGAATATCGCATAGC
GGCGACGCGTTTGGCAGCTTTTGTGTGGGGCTAGTGGGGATAAATCGGAAGATTGCGTCAGACTGTCGCGAGGTGTCATCCCATTGAAACATGATTCCTT
ACCGTGAGTGCTGTGGCCGCTTTACTGTAGAAGCGAAGAGCAGCAGCTCGATCTTGGAGAAGTGACGACGTCTCCAGCAATTTCCCAAGCTCAAAATAAG
CGTCAGTGTGTCCACCATTTCCAGCGTTCAGAAGTAAGCGAAGAGCTTTATCGTGGGATTCCTCGCGGTCTTGAAATTGGGCAGAAAATGATTTTGGGGT
CGATTCAGTGCCTGTCGGTGGCATGTGGAGCAGGAGCAAGTTTGCGAGACGCGTCATGGCCACACTGCTTCCTGAATCAACAGCCTGAAATGCGAAGTTC
ATAGATTTGTCATCTCAAGCAATTAAGCAGCCATCGTGTTTGAGGGACGCACACTTTGAAGAAATGCCACGCCACGCTCCATGTCCTGTTTGACACCATT
TCCGGTAGTGAAAAGCAAGCCCAGTCGTGTCTGGGCGCTCGAATCACTCTGTAGTTTCACGCCACAGCTCAGTCTCAAGAAATTATCACAACAAGACAAG
AGTGTCAAAGCACACCTTGGCAGCTGCACGCTGAAGGAAATGAACGGCCTTAGCGACATCCTGCTGAATTTGCGTTCCGACGAGAAATAGGCGTCCGAGA
CTTGCTTCAGCGCCAGTATGACCTTGGTCGGCAGCTTTTCCGTACCACGTTGCCGCTTCCTTCTCGTTTGATTCGCACCCGCCTCGACCATATTCATGGA
AATACCCTGTTCAACAGGGATATCAGTCAGGAGCTACATTTGCGCAAGGAGTACTCGCGTGAGTGTTACCAAGTTCGAACTGGGCATCACGGTGTCCTTG
CCCCGCTGCCTGGGCGAAACGAATGTGTGCAACAGCAAGAAGTTCATCCGACTGCCGGGTGTCTTTCAAATGAGCTGCTTTCTCACACTGCACGAAAGTC
ACAACGTTGATGCCATCAGACAATGCCAAGCTTGACAAGTGAGGACAGTTACTATCTTACCATCAGGAGGCCTAGCTGGTGACAAGCTTCGATCTCGCCT
CCAGACGATGCACGCTCAAACCATTTCTCCGCGATCAGAATGTCCTTCTCTATTCCTTTGCCAGTGAAGTGCATTTGGCCCAAGCATGTCATTGCTGGCG
CACAACCGAGGTCAGCAGCTTGCTACATTTCGGTGTGAAACACAACCAACATGTGAGATGGCAAATTCGCCTTCAGTGGCAACAAGAGGACGCATGGTAC
CTTGTAAAGCTCAATTGCTCTTTGAAGATTTTTGGCGACGCCGTGACCGAAAAAGTACTGATGTGCTTCCAAGCAGACTTCGTCTCCTGACGGGCCTGGA
ATCTCCACTGGCTCTGGCGGTGGTGTCGGTGCTGGTAACGGTAAATCGATGCCTGATCGACGAGCAATCGCCATGGATAGCTCCATAAAGAGGGAGGTGT
AGTAGGAGTTAATCTCCTGAAAGGCAAATAGCACTTCCCGCTTAAATGTTCGGTTAAGCAAGAATTTGGCAGTGCGCAGACGCTCGGCGATAGCAGACAC
TTGGTTTAATGATGCCGAGAAGTTCTGCAATGCCACTGAGACGCCTTCATTGGACGCGTGCTCGACGAATTCATCTTCATACGCCGCAAACTCATCCTGC
GCCTTCCCGAGCAAGCCACGTAGCTCACCTCCTAGTCTCACTGCGAGCAGCTTGCGGGGGTCCACACCGTCCAGTTGAGTTACAAGTTTCTCTAAAGTCT
CTCGTACGGTGTCCACGAAGCCGTGCCCCCCTTCGTCCGAATCTGTGCAATCCGCCTCGAAAGATGCAGACGCGGGTTTCTGGTCTTGTATTTCCTTCGC
TTCTTGATTAGCTGGTTGTTGTTTAAGACCGTCTTGCATTTGCTGTGGTTTTTGCTGTTGTGACTGAGAAGTCTGTTCGGCTAGCAGCTCTGGTTTGCTG
GCTTGTGCCCGCTTGATTATTCCGAACATAGTCCGCATGCTGCCATTACCTTCTCCAGTCGAAGTCACTGGGCTCTTGCCGCCAACAACAGGCTGTTTCC
TCGAGCGTGTAGCGTTTGATGCATTCACCACATTCTTCGCAACAGCGAAAAGCAGTTTGGGCTCTCGCGCAGGCTGCAACTTTGTGTTCGAATGGGCTTC
AGCTTTCTTGGCTGTTGCATCGTCCTGGCTCGTCACATTTTCGATTGCAGTTCCAGTTGGCGACATCGCGGCAGGTGTTAAACCAGGCAACGTCGCCGCA
ACAGAGCTCAGATCACTCGCCATGTTCACCTGCAGGACAACTTCAACCAAGACACCAACGCAGAGACTGCAAATATGGCTTGAAGCAACTCGAGATAGAC
GCGAGTTTAATTTTATCACTAGCCTCCCTGCTACTATAGTACCCCATCTTCCCACTTGCCCAAGAAATGCCCGTCAAACGCAAAATCTTGATTAAAACTT
GCATCATCTTCAACACGGTGAGAATGGGTCAACCTCGCCAGCAGCTTCTCATCGTCTATGGCTGGTAGTCCGACACGTATCTGCGGGACGTGCGGTCGTC
ATGTCCATTGGATACTGGGCGTCGGTAGCCGCGCTCCAAGGCCTCGTCGTCTCTGCGCACGGGAGGGCGTGCGTCTCTCGGTCCGCGCGCCGAGTACCCG
CGGTCTTCATAGCGGTCATCACGTCGTGAGTATGCGCGATAGTCCCGGCGTTCACGGGACCGCGAGCGTGAGCGTCCGCGAGGTGGATCGCGTCGGTACG
AGTCTCCACGTCGATCACCTCCGTTATCGTAGCTCCTCACGTCGCGTCCTCCACGCTCACGGGAGCGCGAACGGGGTCGCTGCTGGGGAGGTGGTGGGCC
TCTGAAATCACCACCATTGCGATTGTTTCCGCGGTCCCGGGAGCGCGAGCGCCGTTTGCCGCCCGAGGGTTCACCCATGTTGCTGATCATTGGCGCACGA
GACTCCGGCGCATCGTCGAACTGTCCGTTGCGCCCCGGTGGCGGGGGCGGGGGCCCCGCGCCGGCCGACGGAGGTGGCCGCGATCCTGGAGCGGGTCCCG
GAGGCGGCGGCCCATTGAGCCCCTGCTTGGTCATCCACGCTGGCAGCGTATTGGCGCGTCCGCGTCCTCGTCCAGCCATCGTCAGTGCTTGTGATGGAAA
AAACGGTTGTGAGGATTTGAGCATTTGGCTACAGAATAGCAAGCCAATTCGGTCCAATCGTTGGACTATTCGGACTAGTTTTGACTGTTCGGACTATTTT
TGATTAGCCAAGTAAGTGGATGTCGGGTGCCGGACGGAAGAGCGCGTACCGCAAGGGCGTGACCAAGCGCGTGCTGTACGGAGACCCGGAGCCCAAGGAG
AACGAGCTCATCGTGCGCGTCGTGGCGCTGCGTGGTAGCAACTTATTTGAGGTGCGGTGACGCTTTTCGACCGAGAATTAGTCATTTTAGGACGCTTTTG
GTCATTTTTTTCGTGTTGGTTGCGTTATTGAGTGCAGGTAGTGGACGCCAATGGCACCAAGGCTGTGACCATGTTACCAACCAAGTTCCGCAAGCTCATT
TGGGTCAAACGAGGTATTTTGTTAACTATTCCGGCGGTCGAGTTGGAGAGTTGGCCGGTGCTGGTAGACTGTTTTCTAAGGCATCGGTGAACTCAACCGC
TTGCCGTTTTGTGGCGGTGCAATGCTGTGGAGCATTGTAGCAATGTTTCTGTGCTCGTACTGATTATTTTTTGTTGCTGTCGGTAGGTGACTTTTTGATT
GTCAGCGAGGGCGACGGAGGGGAGACCACAACTGCGAAGGGCAAGAAGGGCGCCGTGACGTCCATCGTCGAGCACATTCTGTATAAAGATCAGATCAAGA
ACCTCAAGCTCAAGGATCTCTGGTATGCTGCCATGATCGAACTTGTTCAATGCACGATGGTGAATGTCTCGGAAGCTTATGTTGGACATTTTTATGCTTG
GGTGACATTATTAGGCCTGAGGCGTTCGATGACACGCCTGCAGGAGGAGCATGGTCGCACGGTATAGCTTCTAAGGATGAAGGAGAGCAGAAGGACGAGA
AAGAAGACGAAGAGGAGGCTCAACCGCCATCGCCTCAATCCTCGAAGGGACTCACGATGTTGGATACGAAATTTGCAAACATGCAAGTGAACCGGAATCG
CCGCAAGGGTCACTTTGATGAAGAGGAAGAGGAAGATAGCGATGACGAGTAAGGCGTGGGCTGGATCAACTCGTGACGTCGGTGTCCTAGACATGTTTCG
CCAAATTTGGCGGCTTGCATATCAATCCATTTTGAATCGAGTTATTGTTAGTCTGTGTGCTCGAGTTGTTCTCTGTTGCACTAAAGCGTTGCTGCAAACA
AGCTCAAGAGATCGCCTCGCACCATGCAACGCAAGCGCAGCAGCATCTACAATGCTGGACCCTCTGTGTTGGTACGTTGTTATCTGCAAGTCGATGCCAT
ACAGTAACTAACACATGATATAATAGCACCATCGGCACTCCCATTCAGCTGTCAGCAATAATCGTGAGAATAATGAGCCACACCTCGGCGTCTTTGGCAA
GGTGTGCACTGCAAAATTTTATCTGTTTGGAACTCATGCGCACTTACCAAAGCTCACATTGGGTTGCAGTATTCTGAAAAAGATTTATTCTCTGATCTCC
GGGTGGAGATTGATCGGGAGCTGGCATCAAAGCATTCCGGACACCTTCGGGGTAAGGCACCGATCATGAAAATATCAGCGACTAGCAAGACAGTCGCCAA
GGTAAAGCCGACGTCAAATGCTGTGCATGAGTCGTCAGTGCTAGCATCATCGAGTACTCGTCAAATGTCCAGGTTCGTCTTCACTCACGCAAATTCGATG
ATAATTTAGTGTCTGATTTCATATCAAAGCAGACGATGTCAGTCAGCTTCTGCAGTCCGAAAGAAGCTTTTCCACGCCGTGGAGCAAGGCTCCAGTAGTG
GCTATCAACACCCGAATCACAAATTGCAGACCCAAGTGGATGCTCTCCGGAATCTTGCGTCGGCATCATTCTCCAGAACCTTGTCCAAGACAAATACCGG
CTACCGCACACATGGTGCAGACACAGCATCAATTTGTCATGGAAAGCAGTCACGAATGGCGTCTGGGATACCTCCAACCGCAAAAACGCAGAACCAAGAT
GAATGCATCGCAGGTGTCGGACTCGCCCCGACTCGGTCAGCAAGTGTCGCTATTCTGATGTCGAATCCCGCGCAAAAATCTTCAAATTCGTCGCTTCCCA
ACTCGTCATCGTCCGTTCTGGTGGGCGGATACAGGTCTTCATCAGTGCAACTCGAAGTAGAACTTGTAGAGCGACTGAACGAGATTGGGCGCTCAAATGT
GCGTTCGCTAGGAGCGCATTCGCTGGATAGGGTTTAACCACTTACCTTTCATTCATTTCAGCTGCCAGAGAAAACTTTGTCACGCACTAGGGCGTGTCAA
AATGTACTGGACAGCATCGTTCTACAAGATGAGGTAAGTTTCTGTTGCTCTTACTGGCAAGATGGCTAAGCTGACGAACTCTTGCGCTGTAGCACTACGG
CCGACTATTGTCAAGAATCCGTGACGAATTCAGTACATATGTTGATACGACGAGCAGAAAGAGTCCTACCGAGTCCAATAACAGCAAGGGGGCTAAGTCC
TGGTGTGCATGCGGGCAGGATGTCTTCGGTAAGCACCTGGATGCTGGATACACGATCGCTCCTCCTGTCTAACTGCAGGACTTTGTGAAACAGAGTTCGC
GCTTTTAAAACAAGAAAACACAGTGATGAAGAAGCGCGTAAACAGCATGCAGAACGAAATTGAAACCTTGCAAGCTGCGTTAAGGCAAACAAGGGCCGGG
AATGGGAGCCAACGTAGCAATGAAAGTGCGCGCGACACGAGCAGCTACAGCAGCTGGACGGAGGAAGATCAAATGGAAGAAGGTAAAACAAACTTGAATA
TCGTGCTTGGACTGGGTGATGTTTAACGCACATACTCTGTTGTTTGCCACGTAGACGATCTCAACGATGTTCAGCTTTTTCCCATCGATGAAATACAGGA
GCATCACTACCGGCCGCAAGGTGTCCCGATGCTAAGCTTTACCTCACTTCCTTCATACAGCGACGAGGTACAGTACGATAGCAACGCCTCGCCTTAACGC
ATTGAGGCATTTAACGTTTTCATATCTCGTGACGTGTAGGAAGAAGATGAAGAAGGGTATTCTCAATAGAGCAGGACTACTTACAGCGATCCTCCGTTTG
CGTTATTTTTCTCGTGAATTGAAGTCGATTTTTTTCAGATAGCTCGGTCTAATCACTCGTTCTCACTCCTTTGTACTTCCAAGCTGACGTAGAAGCTCTT
TCAGTAACTCTTGTTGTTGGCGCTGCTGAGTCAGCGCTTCCCTTGTCAGCTTTTGCATTTGGTCCATTGCAGCAATTACGCGGTACATAGTGTAGATGAA
CATCAACGCGCAAATGATGATAGCAGCTTGTATCGTCGGGTGAAGCTGCGTAAGCTGACTCGTGTTGATGCTCGAAGCGGGCTGTGTCAAGCTTACAGTA
GGTGTAACTTGACGAGTCGGCTCATTTGACGGTTTATCTTCTTCCTTAGTTGCCGGCGCTGGTTTAGTCAACGATGCACTCGCAGCAGCAGAAGAAACAG
CGCCAATTCCAACTGATGATGTTTGCTTGGTTGCATCAGCAGCAGCGAGTAGCCACGTTTTCATTGCATCCTTCGTTTCAGAGACGGTTGTACCTTCAAT
CTGGATGATAACAAGAGTCAGTCACTATAAGCAATGGTTGCAAGTGGTGGCAACGCATTCAACCTAAACAGTGCGTACCTGCTTCTTTAGCCATGTGCTC
TTTAGCCATTGAACGCGAAGTCCCACCTGAACCAAACAAATGCCTCGCTTTGTCGTAGCACTGAAGACCCATCGCTGCTCAACACGGAAGTAGTCGCAGT
ATGGTACGTCCGAAACACACGTTGTTGTGCTGACAACGAGACGGCTCCTCGGGGTGTATGAGTACCTCTGAGTCTGCGCGGTCGGGATGACACTCGGCCC
CACCATGTACTTCTTGTTGTGGGTGTACGAAACCAACCGAGATCCCTCAAAGGTATCTGATTTGTTAACTGCAGTATACTGGATCGTCTTCTTCTCCCAG
GGCGGAATCGAAATATTTGTCGAGCCGGCAACTTCAAGTACGCTGCGCGAAAATGCGTCTGATTCGATCCACAACGTTGAAAACGCGGTCTCAACACTGC
AAACAAAGGTACAACGCTGGTTATTAATGTACGGAATGCCATAAACGTTTTCAGGTTCATTGTACCTGAAAGTGACTTCTTCGTTCAGCACCAAATCATA
TTCGCTCAGAAATTCATCTTTGTCCGGGATCACCGGAGCTGCCACTCCTGCAGAATCATCTGAAAAGAGAGTAGTCGGGGAGCGATTGTAGTCGGCCAGA
CATGAACTCGTCGCATTTGCGGCGCTGACGGGGACCAATTCAGGGCTTGGAGCAACAGCAGCAATGTCATTGGAACTACTTCGTCTTTTTGACGCACCGT
CAGTTACAGTGCCTTCTTTGTCAGTTGGCTGCGATTCAGGTTGCTTCGCTGGGTCTGACAGAAGTGCCTCTGTTTCAGTCTTAATAGAGCGTAACTGTTG
GATACTTTGAAAGCACTCGTCTCTGTAAATTGGACCAGAGAATTTAGTAAATGCCTTGATGCCCAAGTCACTAAATAGTCAGAGCAATTCCTTACCGGAA
AACAAACGAAGTGAAGAACAGTTTTTCTCCTTTCACGGTGAACTACATTTCACATGACAAGAGCGCAAGTCAAAAAATATACTGGTACTTCCGATTAAGA
AAGATTCAATCAAACCTCAATTGCGTTGGGAACAATCAGCGCAGTATTCTTCTTTTCCATCACCGATATTTGAGAGAACGAAGCAACCTTCACAAAACAA
CTGCAAAGTGAGTAGGAAGCCGTAATTGGTGCAAGCAGCATGCTTCAAAAGGGGGCAACATACAAATATCGTGTCTCTCCATCCTGAAAAGCACATACGA
TTTCTTGTCAAGTAAAGTCGTCCATGAAAAGGGAAGTTGGAGAGGTACAGCGCGCATGAGAAACTTTCAACAACTTGCTCAGGAGAATCCAACTACAGCA
AGAGACACACAGGCAAGTCCATTAGGTTGTTGGGTCACATACGCACCAACAAGTAGTACTTCGGTATGTGAGGCTTACCTTGAACTTCTTTTGAAAGTCC
GATACTCCAAGCGGTTGTGCTTCCACGAATTCTTCATCTTGCTCCATGCCTGAGTCAACCTTTTCTTCTTCGTTCGTACAGGCCTCATCTTCGCCTACAT
TTTCACTTGATGGGGTTGTTTGACCATTCCTTGGGGATAGAGTGCTAGCACGCGGAGACGGATCACGTGAAGTTGAAATCTCTCCACTCGGAAGTGACAC
TAACGGGCTGGTGCTGCTTGAAGGGCTTCTAGGAGTCTTGTCCGCAGTTTCCGATGGCATCGAGGTAGAGGATCCCAACGATGCGAGATAATCACGCATC
ACTTCTTTTAAGCTGTCATTGCCATGATAAGCTGGCACGATGCGCTTGCTCCTTTCATACGGCTGTCTGTTAATCCGAATAAACTCAGACATATCACCCC
TCGGATCAATCTTCTCAAATTCACCTAGAGCTTTGCTTCCGACGGATGTGCCACCCTGTAGCATATGCTCAAGAGCTTTCGCCAGCGACTGCAGGGAATT
TTTGCCAACCTGTAGTCGATACTTCTCGTTTTTCATACATGTCGAAATGAAAACTTCCACTTCCTGAAGACCAAAAGTTCAGATTTGTTAAGAGGTAAAC
GCAAAAGGATCAAGCACGAAGAGGCTTACCTGAACATAGATCTGGTACGTCTGTCTCAGAGCACTGCTGCTCTCAATGACTCGTTGTTGTAATAGGCGTA
TCTCTTCGGCCAATTGTCGTAGTTTAGCCTCAGATCTTCTTTCCTTCTCGTTAAATAAACGGAAATTAGCGCTCAGCGACTTCATGGCTTGAGCTACTTC
AATGCCATACGACGTGGCCGCGACCGGAGTCGCGCCTGGCAAATAAGAAAATGTCACCGCGAAATCGCGAGATTTTGTTTCCAACTTCTGCTGAAGCTTT
CGGTGTGCAGCTGAGTCATTGCACAGCGTCAAGTGCACCCTCGAGAAGTTTTCCTGTGTCGTCACTCGAACGTCCTCGTACTCACTCTTCATGGTTGAAA
GACTGAGAGAAACTGGCTCAGCAAGCAATGATTGAAATTCCTAGAGGTTGACCAGCATGCAGCAGCGTCAGTTCAGAAAAAGCAGCAACGAATGCAATAT
GTCATTAAAGCATACCTGGTGGACCTCCAACAGAAGTTTTACTTGATCTCTCGCCGTCATCCAACCGTTCGCCATCGTCGCACCTTCATCGGTCAGAAAA
TTGGTGTTTACACTGGAGGATGATGTACCAAAGAGATCCGATGGCGGGACGAGACCACCACTCTCATGCGTGCGCAGCAGTTTGCGCAGCGATTGTGAAA
AGCGGGTCTCGCTCGCAATAAATTCCGACACGACCGAGTTGATCACTTCGATCATCCGTTGGCCTTTGTCCGACATCGCCTGAATATGCGTTATGCGAAG
ATAGAAAGGGTTTGTCGCCAAGTCTGCGCGATCCACATCAATTTCCTCTTGACTACCAAGGCTTTGAAATCCTTTCTCGATGTCAGCTAATAAATACATG
CAGTATACTTAATGTCAGTATCCACCATAAACGCTCCAAGCCTAGGCAACCAGTGTACTTACCCAACTCGTCAACGCTGTTGGCACTCTCTTTCATCCGT
TCAACGAATTGTTGTGACCGCGAAAACATGCCTACAAACGCCTTTTGCATCCGTACAAGAACATCTCGCAAATATTCCAGGCGTTGTTCTTCCGTAAGCT
GAAACGCGTGAAGATTCTCTTTGGTTTCCCGCTCGGAAATCAAGCGTTGTGCATTGGTGTACTCCACCGTTTGGACGTAGTGTTTTTCTGCGGCAATGAC
TTCTTCAAGACAGCTGTACAATTTGGAGCGTTGCCGCTCCAACGGATTGCGGCCAAAGGCCGACGTGGTATCCCACATCTTTGTCAATAATTGCCCTGCA
CCTGCCGCCAACTTGTCCGTCAGCTCCTTAGAGGACGAGACCTCATCAGACGAATCTGAACTATAATCCCCGGCATTTGGGTTTTCACTCTTCCGCATGG
ATGTCGTGATCTCAATAGCTTCTTGGCATTTGCGTTCGTACTTCTCCCGAGCCTTGTCCATCGAAGTAGTCATTTGCTGCTGAGCCCAGCGCACCTTGGT
CCCCTCTTCAACACACGTTGCAATAAAAAACTACGTTAAAGACTTTAGGACGCCCCATGTGCAGGTACAGATCCACCAATTGTTGCCACAACGAACCTGC
AATCAACCGCTGCACCTGTATCTCCTGCTGCGCAGCAAATGCCTTTGCACCTGGTACAATAGCAGTCTGCATAGTCGACGCGAATGCCCATCGCTCTTGG
GCCAGATGCTCCATCGCCTCCTGGACAATAACCCAGCAGTCCGTAAGCTGCTCGGACCAGTCCTCGGCCTTCGCACTCCTGCACACACACCAAACAAAAA
CAAAAAAACCAAGTTAAAACAGTTCAAAAACCGTTGCAGAAGCTGCCTCGTACTGCGCGAGCTTTAGCAGCGACTGAGCGTAGCTGCACTCCAAGCCAGC
ACGCTCCGTCACAAACGCCGAGACTGCTTGGCAGAGCTGCACGCCGCTTTTGGCCTTCTGACAGACTTTCGGGAACGCCCGGAAGAGGTCAGTGGAGTAG
GTTTCTTGGGTCTGAGCCGGGTGGGGAGACGTCACAGAACCGTCATCACTCCTAGTAGTTGGGCTGGTGTTATCTGAAGTAGAAGGCGGTTTGGAGGCGG
TTGCGACGTTGCTGGGACTGCTCTGGGGCTTGTTCTCCGCTGGAACATCCGACAACGTGTCCACTTTGAGATCCGGCGCGTCTTCTGTTGGCACCGAGAA
GCCGAGGAGCAGGGAATTGCATACGTGAGTTAGTGGGGGGAAGGCAAGATGGAGGAGCGCAGGACGTACCCATGGCGGAGCTTGGAGCACTGTGTCTTCG
GTGCCGCACTTTTCACACTGAAGGGCGGACGAAAATGGACGGGCCGTTGAGCGAACTCGGCATACAAAACGCAAGTGAAACGTTAGGAAGTGTCACAGGA
TTCACCTGGATAACCTGCAGACAAATGCACCAGAAGGGATCTGGTCTTAAGCACGCGGCACTACCAAAGTTGGCGCACCTTGGCATACATGTGTAAACGG
ATGAAATAATACTTAAGACGATACGATTTGGATGTTGAATGTTATTCAGCCATTATGAGAGCACCTACGAATGAAGAAGAGTGCCTCGCCACGCCCTACT
TCAAGCCAGAACACTACTTAGTACTGGGCCTTCTTGGCAGCCTCGGCAGCAACCGCCTTCTCGCGCAGCTCCAGCTTCTTCTGGGTCTTCAGGCCCATGA
TGCCACCGCCCCACTTGCGACGGATCGTGTTGTCCTCGTTGAACTTGGCGTGGAAAGCCTCCGTGAGGGAGTCGAACTTGGCCTTGTCCTCCTTGTTCAC
GTGCGTCAGCGCCACCACAGCAGCGTTCTTCTGGTGCACGAGCTGTCCCAGGCGCGACTTGCCCTTGACAATGCAGTACGGGATGTCGAACTGACGGCAC
AGAGCAGGCAGGAACACCACGAGCTCAATGGGGTCCACGTCGTGGGCAATGACCACGAGCTTGGCCTTCTTGTTCTCGATCAGCGAGGTCACGTGGTTAA
GACCGAACTTGACGACGGCGGGCGGGGCCGAGGCCTCCTCCTTGCCGGCGGCAATGTTGCGCAGACGCAGGGTCTTGGCGGCCTTCGTCTCCGGCTGGTA
CTTCAGCAGCAGCTTGAAGAGGTCCGTGGCCACGTTCTTCTCCACAGTGTTGGAGAACTGGTTGACCGACGGCGGCACCTTGAGGCGCTGGTACAGGATC
TTGCGCTGACGCTGCAGGCGAACGTAACGCGGCCAGCGCACGAAGCGGGACAGGTCACGCTTGGGCTGTAGAGATCAATGTAAATAGAAAAAAAGAGAAA
AGTCAGTACTACCGTCCTGTATACTGGGTGGAGATGCCTCCCCACGCCAGAAAACCAGTGAGCTTTGACAGCACGGCAGAGAGCGAGGTTCTTTACCCTT
GAGGCGCAACTCATCGCGAGCGAATGAGATTGCCACCACAAGTTTGTGTCATTGCGGTCGTGGGGGACCCGCTACACTGTTCTCTAGTGAGACGGCGAGG
GAAGGCAGAGGCCGAAGCTTCCGTCTCCTCAGCGCCGTCGTCACCGAGGGGCGTGGAATCGCAGCCAAAAGAGGCCAAGCGATTGGATGTGGAGCTGCGG
CGCTTCAAAATACCTGAATGTCACCACCCTTGCGGAAGTTCTTGGGCGTGCTCACGAAGAGAGGGTTCTTCTTCGAGGCGCCGGCCGAGGCCTTGACCGA
CTTGGTCGACGTGACCTTGGTGGTGGTGGTGGTGCGCTTGACCTTCTTGGTGGGCATGGTGATCGTAGATGGCGAATAAACGAATGTGGGAGCTCACCGG
CAGGCGGCGAGTGCCGCACGCACCAGCCAGTCATTCAATATTGCGGCTTTTCATCCAATTAAAAGACGGATACATAATAAATGTGGACCACGTAGAGTAA
TATGGTGTCACTCATATGAAGGGATTTAGTGACACATGCAACTTGAAGTGAGCTTCAACACGAGAGGGCAGCTACGAGCCGCCGGAAGACGCCGACACCG
TGTTTAAGGACGCTGATTTTCCACTGTACGCTGCGGTGGAAGTAAAACGCGTCTTCTCGGCGTACGGGATGCGAAGTGACGGCGCGTGCTGGTACATGGC
GTTCTCCTGAATGGCGGTCAGTAGTACGTGCACGCCAGGTGCAGTGCCAAATTCCTACGCTGCGCAGTCTAACGTCACGTGCTGCGGTAGAAAGCGGCTT
ATTCCGTCGCACATCAATCCACTAACAGCGTCAAAACCTTCAGCCAGCCCGCCGTCCTGGTCCCCAACTACTACCACGTCCCGATCAGCGCATATGGTTT
GGGCTCTCTGAGCAGCGCCGCGGCCTCCACCAGGATTCAACACCAGAGAATCCTGGCCTGGAGGACCTCCACCGCCGAAGTACACCGTCGTCGGATAATG
GTAGTTCCCGCTAACGACAGCGCGCTTGCCTGCTACGAATCCTTTCGACACAATAGTCGATAGCATTCCAAACCAGACGTCGAGCGACGTCTCCCAACTG
ACGGGTGTCTGCGAGTTAAGCACATCGCGAATATGATCGTACCCACTGGACCCCAGCGCCCGTAGCCGCTCAAAGCCTTCGGGTCATAAGAAGTTACGGT
TCAGGTCCACGTTATTTTCATTAAAGCAACGAAGCTACATTCGGGAACACGAACAGCGATTAATCCAAGTCAGTCCAAGCAGCAATCAGAGAGACAAAGT
GTGTATGCTTCGAACAATCTTACCTTTGCAAAGTCGTACGGATTGAGTGCATGCACCATGATAATCGTTGGTGGATCCGATTTGCTACTTTCTCGTCGCC
CAGATTCGCAAGAATTGATGACTGAATTGCGCTGCCTGCAAACCCCTCAACCCCGTGTGTATCGGAAATGTGAGGTACTGCCTTATCGTTGGCTCCCTCG
ACAACGACGACATCAATCGTCAGATCCAAGTGCGCGTAGTCTGGGAGCGGTAGTGAGTACAGAGTCACGTCCTGCGGTGAGTTTTTGTCGGCGTGAACTG
CTCTGGAACGGAAGAGTGCGTGTGTATCGCAATAGGATGCGGAGAAATAGTTTTCCACTTCGGCGTCCACCTCGGTAGGTGGGAAATACGTATCCAGCGG
TGCGAAGTCGTTCAGCATGTGCACCCAAGCCGCGAGTGCTGCGGCAACAAGCGTCAGCCACAGCAATGTCATCCTGCCGATCTTTTTTGTGGCTTTTGAC
AACTATTTTGAATCCAAGCTTCACCCTGCGGTGTCGAGTGAACCAAAGTGCAGGGTCGAAATCATTCACTTCGAATTCGTATTTCCCCAATTAAGCAATT
ACTACCTGTCAGACTGGCCATTGTTGCCTGCGATAACTCCACAACCTTTCCCTTTTACAAGGACAGGTACCGGTGGAGCCGATCGTACACGTCCGCACCG
CGACGTAGCACCTCACTCTTCCAGGAGCTGCTCTGATGCAGATAAAACACGTCTCGAAGCTTCTGCGCGTACGGCAATCGGTTCACGGATGATGGGCTGT
GGTGGTACATGGAGTTCTCTTCAATCATTGCCTTAAGAATAAAGACGCCTGGCACCGTCCCGAACTCTTGACAGAACAAGAGCGTATTTCCTTTAGTTTG
CGGGCCCAATAGATTCGCCACACCATCAAACGTGAAGCCGCCAACTCCATCGTAGCCACGCGACACGGGGTTTTCGTTATCGTGCACAAATACCACCTTG
TCCGCGTACTCCGGGCCAGTGAAGACACTGCGTGCGACGACCATATCGCTCCCCGCACCCAGCATTAGTGTATCGACACCTGCAGGTCCAAGTCCCGTGT
GCACGTCAACCATTGCGAACTTGGTAACAGCATCAAAGTCCACATGCTCGCGCAAGAACGCCTGCAGCAACGCCAAGCTAGGCTCGAGCTGCGTTCCACC
GTAGAAGATCGTATCCGAAAAGCGGTAGTTCCCACCAATAGTAGCCTGTTTGATGGTGTCAAAGCCCTTCGTAGCCAAATGCATGATGGCTTTCACCCAA
AACCAGTTCTTGACGCTGTGCAGATCCTTCGGGTTCAGTAGCTCGTAGACGTCCAGGTAGCCCAGCCGGTTCGGGTCTCTCGCCTGCCGCTCCTCGAACT
CCTCGGGCGTGAGCCAATTGCGGTTCAAATCCACGTTGTGCTCATTAAATCGACGCAACTGAGCGAACCCAAACGCATTGAGCGCGTGTACAAATATCAC
CGTTGGCTTGAGTTTGTCGGTGTTCGCTCTAGCAACCGCTCGCTCCAGCAGCGCCGCCTGGATGGCGCTCCCAGCAAAGCCCTCGACGCCGTGCGTGCCT
GAAATGTGCAGCAGCACGCGCTCGCTCGAGCCTGGAAGCACCGCAACGTCTACAGTCAGGTCCAGCGGGCTTAGATGCTCGAGAGGAAGCGAAAACAACT
TGGCGTCGGCTGCCTTGGCGCGTGCGCGGAAGAGCGCTCGCGCCTCGTAGTACGAGTCGCTGAAATGAGCCTCGACGCTGGCATTGATGCTGGAGGACGG
AGTGTACGAGTCGAGAGGCACAAAGTCGTTGTAGGCGTGCAGCAGCAGCGCCCCCAGTAGCGTGGCCAGAGCAGGCAGCACAGCTCCGAGCATGGATAAC
AAGCCCCACACTATTACCGGTAAGTGAAACAAAGTAACTTGCATTTCGAAACCTGTTATACCTGTACTATGTGCGTTAACATTGTGTGACACACTTAGCG
TATTATCAGAGCCCAGGGACGATCTGCCGTCGAAAATCGAGACGTGTCTCTTGCTGCGTCGCTGGGCAGCCTCAGTGCTTGATCGACGCCATGGGTCAGC
ACTGTTCGTGTCTGGAGCACCCACCCAAGTACCAGAGGCGGGAATCGGACGACATGGACACGGTGGACATAGAGAGAGGCGATGACGACGACCAGGAACT
GGAGGTGCTGGTGGACCAGGCGCAGGAGACCCACGAGCTGCTCCGCTCCAGTCCCAGAGCGACTCCGGGCGGGCGGGACAGCCTCCGTGGTGCCTTAAAG
CGGACCGGATCCGTCGTCGCTGCAGGTTCCATGGGTGAAGACGAGAGGAGGGGAGACGAATACGAGGAGAAGGAGTCGGAAGAGCAGCACATGCGACGCA
GTCTCAGCACCGGACTGATGGGGCTAGATATGAACCACCAGCCGACACCATCGCTTCGACCCGAGGAGCTGTCAAGGCTACTGCGTTCTTATCAGGAGGT
CACGGGCGTGGTAAGAGTTTGCTTTCAGAATGTTCCCATTCCGGTGCTCGTGCTGACCTCGGGTGGTATTGTCTACGGCAGGTCGATGAAGGCCAGTTAG
ATCTCGAGTGCATCATGTGCCTGGACACATTCTCCGAGGTGAGGACAGCTTCGATGGTTTGCGTGCTGGGATACGAAGATTGCTGACACAGATTGTATTT
GTACAGGACAACCCGAAGGTCCGAACGCTGTGTAACTGCGGCATGAATCGCACCAATTTCCATATGAGCTGCTTGCTTGAGTGGCTCAATCGCGACACCA
ATTGCCCAGTTTGTCGGGAGTATCTCTTCTTTGAGGACTGATACTCCGACACGATCGTCAAGGCCAGAATTTATTATGCTGACGACGTAATTCGTATTCC
ATCGTGAGAAGCCGAGATTGCCGACAACAGAACTTTTTCCATGCCACTGGCCAATCAGCGATGAAGGTACACAACGTGACTGGCATCTTCTAGCAGAAGG
CTAGTTCTTTTGACGCGCATCATGCTTATTCTTATTCCGTAGCAATAGTGTTTACAGTCGCCGCCACGCGACAATTTTGCTTCAATGAGGCCATGACACG
GCCCACAAGAGGACATAATGTCCTCATTAAATTCAATCTGTACTCTATTTCTTTGGCATTAGTCGATAAGATTTTGACTTTAATCAGCGTCCTCGTGCTA
GTTGTGTCATTGCTATCATTTTGCTCACGTCCTCATTCCAATCCGATCTCGAAAAGCATACGCAGACGCTATCGCTACGATGCCAATCGCGACAGCCGTG
ACAATGATAGAAGTCTGAGAGCGTAAAGATACAAATGATCAGTTCGACATCACCTGTGTTGTTAGTTGTAAACTAACCTGCCAGCTCTTCAACATGTGAT
TCGATTTGTCTCCATTCCTGTGGAAAATAAAGATATTACATCAGTCACCACAACAATCAGTAGACGAATATTCATGATGAACTGAACACCGTTCTACCAA
CCTTGGCCGCCGAGGAGGTAGTGGTGGAACTTCCTTGAGCATTGGTGAAGTTGCACTAGGCCACGGTTGGTATTCAAAAGGAAATTGGAAGTACATATTT
GGGCTAGGTGGGAGCGCGCATGCACGAAATCCATGCCTTTGACGTTAGACACATCACAAACATTTGAACTTGGCAACGTAACGTACACTGCAGTAATGTC
CACTTCACTTCGCCGTCGGAGTTGTTCTGGCGGCAACTGATGAAACAGCACAAGAGCACGTGCGATCACCTTCTCCACGTCCATGGTAAGCGGCAAGTTC
GACAGCATTCCGTGCATCGTGCCAAAGTCGCGCTCGCAGCGCAAAATCTTTTCCCTCGACTCGAGCACAACCTTCAAGCTTGGTTAGTGACAAGCTAGAC
TCCCACAGCACTACGAATGAGAGGAAGCACTTACTGCAGCAGACACGTATAGACTGAAAAGCGGATGGGTCACGAGGAAAACGTCGTACAGCCGCGCGAC
ATCTTGGAAACGCCTCAGTTGGTGCGCAAACCACGTAATCAGCCATGGTAAAGCGAAGAACGGTTCCACCTACACATTCGCAGCAGTAATGCATGGTGAG
AATAATCCGCCGAAAGCGCGTTTGCACCATCTCAGCCAACGACGCACCCCCGATTCATACAGATGCTGGAAAAGCACTTCGTCCGCTGCATCTAGCAATG
GAAACAGTAGCCTCGTGGTCGCCATCACTTGTTCGAACCCCGAGCGCATCGGCTCGCGTTGATACGCCTCGCTCACGTGCAGGACAGCTTGCATCGTGCC
CTTTGAGTTTCCCAATGTCAATAAGAACACGGACACGATATCGTGGTACCCTTGAAAGTAGAACAGCTCGTCATTGGTGTCCAGCACGCCGAGGATGATC
TGCGTCAGTGCGCGGCGCTTGACCCGCCGCTCGCTCTCTTTAAAACCCTGCAGCACGTCGTAGTGCCACAAAGACCGCTCCACGTCCTTCTCGATTTGAG
CGGCATCGCGATGCGCTTCCAGCGACGAGTTTCCGGTGTGCGGGTGTTCAATTTGCGCTGCACTTGCAGTTGCATCATTGCCAAGCAGAAATGGCCACAA
TTCCTTGCGGAACTCCCCCGAAACCAACCCTTTCGGTGTTATCGCGAGGCGGCGCACTTGGCGGAAGCACTCGTCCCGCTCTCTGGCGGTCGCGTCGTCG
CGATCAAGAGAGCGCAGGCGCAGGATAAGTGTGCGCAGTTCCGTCTCCTTGCGTTGGATGAGACGGCGTTCTCGCTCGGCGGGTGCCCGGCCCGGGATGC
CCCGCACACGACGCCGGTCGTGGGCGCTTCGCTTCTTGTTGCCCATGCTGTTGCGTTGGATACGGTGGCATTCACGCGGAGGAGGTCAGTAAAGCGAATG
CTGTGCTGTCGTCATTTTTAGCCAAATTGTGGTGTCGACATAAAACGAACGGCAGAAATTAAAACGGAAATTCTCGCTGGATGGGGGGGGTACATTGGAT
GTGATGGCGTCCGTCAAGCAGCCACACTGCGCCACATGTAACACTGCTGGTATTATAGCAGAGCTGCGGCAAGCATGTGTGCTTTCCCGTCGGGGTCAGA
GCCCTTCCTTTGTTTTTGCGTCTCGTCGAGATCGCTCAAGATGAAAATGGACCTTTTTGCTGTTTAAAATCCAGCTTCCTGATTTCACAACTTGCCCCCG
GCGCAAATGCCCCCTATTTTTCACAGGATATTCATTTATGAAGGTTTATCACACTAGTAAATCGTTCCGTTTGCATGGTTTTTGCCAGGCTATCATATCT
CGGGAGTCTGATTTTTCCCGCCCAAGCATCGTCGCCTTTCACTTGGGTTCAGTATGCCGGTTACGCCCGCGGCGGCGGTGGCGGTGGAGGCGGCGGCAAC
GGACGTGGCTCAGTGCGGGATCTCGCGAGCCGACAGCCAAGGGTCCGCAGGAAACACCGATTGGACGATCGCTCTCTTCCTCGCCCCATACTGCGTGAGC
ACTTGCCAGTCGCGATCCGGCGATAAGACCCTCCACCAGCTGGGCAGTCGCACGTGCACTTAGCCAGGACCTCGAGTCTCGTCGAATTGGCACTCGCTGT
CTCTCTCTTCCTTCCCCAGGCCCCCCCTCAGTCAGTCTCGAACGCCCCGCAGCCCGCGCAACATGGCGCGTTCCGGCAGCGACGGCGACAGTGATGACGC
CATGCAGTACAGCAAGCCGCTGCGCCAGCAGAAGAAGCTCTGCGATGAGGGCATGGAGCTCGTGAACGCCGGCGTGGCCATGCAGAACGCGTCG