Description :
From Genome Similarity Track
Location :
Scaffold_634:1429- 5776
Transcript NameFunction/comments
g11536.t1hypothetical protein

Sequence
4347 bases(100 bases per row)
GTACACTATGTTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAACGCCTTGAATCTCGATCTCGACGTAACCCTCGACATGGCC
ACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAG
TCTGGATAGGAAACTGCCTGCGTCTTAGTCGAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAACACGATGCGCGGGATCAACACATGCTGGCCGTG
CCTGTCGCCGGCCATGATGGTGGCATGGATGACATGATCTTTGAGCTCGACGATTCGCAGGCGTGTTCCGTTGCACAACCCCAGGTCGGGATTTAAGTTC
CGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTGAGCACCTCCTGCTCGAATAAGTTCC
CGTCCTCGTCATCCTCCACTGAGTCTGTGGACACATATTCTCGAGCTGGTCCAGTCATGCGATCCGCTACGGCTTCGTTGATACGATGTACTATCGCGTT
CGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCT
CGCGGAATAGCTCCCGGACGGATCCCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCGCGTGGAATCTTAATGTAGTCATTTCCCA
GATCGTTGTGTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCACTATCGGACGTGGCAGCCGTGCGAAC
ACGCATGTTCTCTGTCAGACGCACCTTCTGGAAAAGTGGCCACAGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTCGCCGAGCCGCCCTTCACC
ACCGGGAGAATTTGCCTGAAATCTCCCGAAAGCACAACGACTTTCCCACCGAAAGGTTCTGCCTCGTTATCCAAAACGTCACGAAGCGTTCTGTCCACTG
CCTCAAACGCGTGCCGATGCGCCATGGGTGCCTCGTCCCAAACTATCAAACTTGCTTTCCTCATCAATTCCGTGACCTGGAATCGCTTGTTGATGTTGCA
AGTAGATTCGCCGTCTATCTTCAATGGGATTTTGAAGGTAGAATGCGCTGTCCGACCTCCCATGAGCAGCAGAGAAGCAATCCCACTGGAAGCGACCGCG
ATTGCAAATTTTCCGGATAGACGAACCTTGGCCAGTATGTTCCGAAGCAGTGTCGACTTCCCGGTACCGCCTGGTCCATCAACGAAGAATAACTTCCTGC
CTTCCTGTGGGTCCTCGACAGCTTGGGTGATCTGATCATAGGTGAAGCGCTGCTCCTCGTTTAGGTGGTCCTCCTCGCTCACAATTTGTTCAAGAACAGA
CGCGTCATATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAACAGACTCAAGCACCAGGTGAGGGAACTCGCTCAGCCGAGGGAGATCAAAGTCT
TGGACGGAGTACCCACTGACACTGAGCAAGTCTTGGATACTCTTCAGTGTGTCAAACGTCACAACAGACGTTTTAAAAGGGTCCAACATCTCTCGGTTCC
TGTACGCATAGTCAAGCGAAAGGTCTTTGAAGAATTGGTCCCAAAGACCCCGAACATCCGTAGGCGCCGAGTAGACCAAGATTGTTGCAAAGAGCTGGCG
CAGCTGGTACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAACCATTCGCTGTCGTTCTCCAGATAGCCGGCATGTTCAGCCGCGTCTCAATACG
TGGGACACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACCTCAGTCCTCGGCGATGGCATAATAGCAGGCGTAAATAGAAGCGCTCCATATCACG
CGGTGAAACATGCACCATCCGACCAATTGCAGCCTGGTACCTTTTACGTCGAACCCAGCACTTTGTGTTTCCCATCCAGCGGAATTCCTTGGGTATATCC
TGGTACAGCATTGTCTTCGCGATCTGGTTCTCGGGTTCGTCGCTCGCACACAATTCGAAGAAGCGGGTCAACATGGTGTGATTCCCACGACCAAGGACAC
GCTCCGGGTCTTCCGTCGCTCTGAAGAACACGGTTTGGGCATCTTCAACGTGAACGGTAAGCTGAGTGACTGCGTGTGTCTTTCCTTGGATCAAGAAGTC
GAGTAAGCGGATACAGGCTTCAACTGGAGATATGTACCTGGCCGTGAGGAAGCGCAGAATCTCGTTTGGCTCTTGCCGAGGGAGCTCTCCACCCGCGCGA
ACTGCCTCGACAGTTAGCACAGCTTTATCGGACCCTTTGTAGACGTACTTGTATAGATATTTCACAGCTGAAATATCCGTGCACACCTCGACGTTGATGT
GGCAATTGTACTTTTGGGATAAGTACGGGTTGTACGGAACAACCCACTGGTTAATAGTGGCGTTGTCGTACTCCCTGCCCTTCCATACCAGGACGCCTTC
AGCTCGTCGACGCCGTCTGTAGACCGGATAGCCGTTCACATTGGTCCTTGTCGCCTCTGCAAAAGGTTTCGGATATCCTTTCGTACACTTCCCGTCCTTC
ATGCAAGCGCATGACGGGTTTGCCGCTCCACAGGGTCCATGCAGCATGCATGTCATGATTGTCTCGAATAGCTGCGGGAACTTTTCTCTGTCAGGAAGCT
TTGCAGACACCATACGATCTACGATTTGGCGAGTACGTGGCTTGTCCTCTTCAGCCAAAATGATCAAGATGTGCGCGTGAGGGAGCCCTCTCTTTTGAAA
CTCGACCACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTCGCTCAGGTCTTTAAGCTGAGCTTGCAGTTTTTGCTGCCAGACACGGGCTACAATA
TCGGGGCGGTCCTGAGCGTTTTGTTGATCGGACCCAAGGGCCTCGACTATCTCTTCCCATGTAGGGCTGCACGTCGTTGTCATGAACACATCAGGCTTGC
CGAATTCTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACATTGCGCGAGGACTGCCCATATGAGATGAGGGCAGAATAACGCGGCGTCCCACTTG
GTTGAGAAAATGGGTATCACCACCACGGCCTCGATCAGGGTGGACCAACGTACCATCGCCTCTGTCAAACTCGGAGAGTAGCCCTTCGCCTGCTTCCAGC
TGAATTGTACCTTCGTTCAGCAGTGCGTCCTGAAGCCCTCGGTACTGATCGGCGCGAATTTGCTTCTGATGTGAGGCCACCCAGCGAAGTTGCCCTGCTC
GCATTTAGCGCGTTGGTCGACACACCACTGCTGAAAGAGACGGCCGCCTTGATGAAGCCTTGATGAAGAGCAGACTGATCTCCCACTTTTTGGTGCAACC
GGAAGGCGACATGTTCGCGAAGGGACATCTGGTTCTTGTTGCGACGTCTGACTCCGTTCGCGTATGTGTCTGTGTAGGTCCAACCCAGCTCCCCATACGG
AAGCAGAAGAGGGTACTGAAGAGGATCATACTCCGGGCGCGTCTCGAACAGTCGCAGAAGCCTGTGATCCCGAGTATACAGTAGTAGATCGCGAGGCCTA
TCCAGGTTGCCGTCCTCGATGAGCGTCGCGCCTACCTCAGAAACGGTTGGCAAATTGTATGTCCGAGGATGCGCTATATTTTCGTGGAGGCGGAACACCA
TATCCACGACGTCGCTCGTGTCTCGCGAGCGCACTTGCTCTCCGAAACTCAGGAACTGCTGAGCAAATGGGTTGTGCTGCTCCATCATTTGCTCAATGTC
CATCAACGCCACAGGATCCAAGTCAGCAAAAATTCCTCTGCGGCGTTGGGCGCGCTGCTGCATGTCCGGGTCCACAATATAGATCTGCGCGAATTTAGGG
TCCGTGCGCTCTCCGGTGGCGGGATCAATATAGGGGAGTAGAGATCCCAAGTAGTGACCCATTGCACCCTGGATGCGGTACGTGTACACGCCCCTCTGTC
CCGCTACGCTTGCATCCTGGTTGACCTCCTGGAAGGATCGGTTGGAGCACGAAGCGCCAATGGACGTGAACGCAAAAGCTTGGTTATACGCTCGTATGTG
TTGTCGAAACGCTGGATCCCGGTACAGTTGCAACAATCTTGGAGGTGCAGGCCGTAAAGGGGGAAGACGAACCTTGTCTTCCAGACAACAGCTCATTTTT
GATTCGCCAGGCCACTTCCAAGCGCCACAATGTTCACAAACAGTGGT