Description :
From Genome Similarity Track
Location :
Scaffold_5:14285- 16579
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_01826Hypothetical protein

Sequence
2294 bases(100 bases per row)
GCGTACATTGGCGGCAGCCATGTGCTTCTCAAAGAGCCCGAGCACCTGCTTGCCCCACTCGACGACCGACCCGAGGATGTGGTCGCTTAAGTACACTTGC
AGCGACGGGTACATGGCGACACCAAGACCGGCTTCTGGGTCGTACGCCGAGCTGGACGACCCTTGGTGGTTGCGCGCGGTCGCGCCGGCCTTGTACTCGG
CCAGAGCACGCTGAAGGTTGCTTTTGAACCCCAAAAGCGTGGCTTGGAGACCATCCGGAAACTCGTCACGAGGTCGCTGTGCCAGCTCTGTCGTCGTCTC
AGTGAGCGAGAGCGGGTGCAGCGTGGCCAAGAGCGCCGTGCACGTCTCCTGCGAGAGCTCTGTTGCCGACGCAAGGGCCTTGGCATACGCAGCATCAAGG
GTCGCGAGGAGCGTGGTGATCTGGCCTTGGAGCAGCGTTTGGGCCGCGGCGTTGGTTACAGGGATCTGCTGCGATAGCGTGTAAACCTCGACAGACGCGG
CGCGGAGACTCCTAAGGTGGGCCAAAGAAGCAGGCGCGACGACGGGATCGTGGCCGATTCCTCCGAGGCGAGCGGCACGAGTGATGCGAACGTCTGCGTG
TACTGCTCGGCCGCACGCGCGATTCCTTGCTACAGACAGACTAGGAGTTGCAGGTTTTCGCACTATATGCATCGTGTACCTCGCACGTCACGCGGAGCAT
CTTGGTCGCAGCGTGCTGCAGGATCGGCAACTGGTGCGTGTTGAGCGACTCGACAAAGTACTCGACGAGAATCCGAAACTGCGCAGGCGTGATCGCATTG
CCCGCGACTTGCTTGGCCGGCAAAGTGTCTTCGCCGGCCTCGCCAGAGAGATACCGCGAATGCACCTTGTCGGCGGCGACGACGTAGTCGGGCCGAAGGA
CGTCGCGCGACAGATCGTACGTGAGCTCGATACCGGCGCTGGCTTCGACCGCGCGACTGATCATCATGCAGTCGCGCGTGGGGAAGAAGGTTGTAAAATA
CGTCTTGAACGCGTTGCTCTGCATCACAGCCTCGCTAAAGCCCGACTCGAGCGCAAAGAGCCCATCAAAGTACTCCGTGGGCGTCTTCTTCGTGGCGGAC
CCTGGGTTGGCGAGCCACTTGACCTTGGAGTTGCGCGCGACCCACACAAAGCGCGGCAGGACGCTCGCCAGGTCCTTCATGACGCCAGCCTCGTCCTGGT
TTGACCGTAACTTGAATTGCGTCGGGAGGTCTGCGATCCAGCGCAGCTTCTCAAAGCTGAGCTCACTATCCTGGCTGTACAAAAGAACGGACGAGAGGAG
CACCAGCAGCAAACGACCGAGATGCTCGTTCTTGGACGCGAGGACGATGACGTTGGATGCTTCCTCGGCATGCATCCAGAGCAGAGACTTCTTCTCATCG
TCGCCAGCGTCGAGCGTCGGAAGGCTCGGCGACATGGTGTGCAGCAGCAGCTGATGCTCCTTGGTCGACGCGAAGGTCGCGTCCGCGGGCGCGTCGCCGT
TCATCAGACCAACGACGCGGACGCGGCCGGCCGCAGCGTGCGTGAGGTAGACGTCCATGGCGCCATCGTCGACCTCGAGATGCTCGTCCGCGTGCTTCCA
AACAAGGACCTGCATCACACTCCGCTCTTCTTCGGCGGTCGGAGGTTTGTTTCTGACTTTGGCCTCGCGCTCATTGGTCGAAATTGCAATTGGTTGAATC
GCACGCTGTGATTGGCCCGGCGTTTAACCTACTAAAACGCAGTTCGCGCGCGTGGACGGATTTGGATGATGCGAGGTGCCCAGCACGGCTTTCTGGCCTG
CACCACAGTCGCAGATTGCGACGTGGGTACCCGGCACTCACAACCCTACCCAAGCAGCGCATCCTTTCAATCCTGGCTAGGCCAACGTAAATACAACCCC
GAGCCTTGCGTCAACGCACGCGACTGGGTCATTTGGCAAAGTGCAATGTCCACACTGCGCAGAATGCCAAGATCAGAGTGTGCGTCAGCGTGTGCCAACA
GCAACGCTGTCGTCAGTTCAGCGACGGCTCTTGTTGCTTTGTTGCTGAACGTACCGCACTGGCGCGGTCGAAGTTGGTGTTACAACTTCGAGCCGCGGAA
AATCGCGCGATGCCGCGTTCGGGCTCGAGCTCTTACCTTATGCGACGCCAACGCGGGGATGTGGCGCTGCGTATAAACTACTATATTTATGGCCTTGCTA
GTCGTATCAAACTTCTTTGAAACGGCTTCGATGAAAAAGTACGAAATGCCGATAAGGTGAACTGTGTCTCTTGCCGCCGCGTCGACTCGCGCCT