Description :
From Genome Similarity Track
Location :
Scaffold_19:142837- 144685
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10215hypothetical protein

Sequence
1848 bases(100 bases per row)
CCGTCGATCGTCGTCCACACCCGCGTACGTGCCCGAGGCTGAGCGATCCGAAGACGTCGTGCTGGCTCACCGCGTATCACTCGACGACGAGCAACGCGTG
AGTCTGCACGCTATTCTCTAAACTCCATTGGATGATTGGATGGAATAGTGCAAGGGTCAGTGTGGCGAAGGTGACGGTGAGTTGTTTAATTTATTTGATA
TGAGCGCAGGCGAAAACCGGAGGGAGAAAACCAGCAGAAACATTCGAGCGTCGACGGCAAAGCAGGTAGGAAGTAAGGTGTTAGATACTAGAAAGATGCG
CCTTGAGCACCGAGAAAGTCATACAGTAATGATAACCGTCATATTTGTTTTATCCAAACGCTACTACATCTAAGTGTACATGCAGTCACATGCAGTCTTG
GTACAGAAAGGCATGTTTGTTTCTTGTGATGTTTCATTGTGTCTCTACTAGAGGCTCTAGGTCTGCCGTTCAAATCGCAAAACGTTTTCGACAGCTGTGA
GGTTTGAACTCACGCGGGTTACCCCAATGGATTTCAAGTCCATCGCCTTAACCACTCGGCCAAGCTGTCGGCGAAATAGATGGGCGGCAAATTCAAATAA
TGAAATTTAAATTTGCCGCTGCTTTTTACAATGAAATTCTATGGAGATCGAGTTGTGAAATTTGTGCGAATAGTCACGCCCAAAAATATATATCACCCAA
ACAGTTGGTCCAGACCAATTATCTCTATAATTAATGACCAGGTGTATCAAATATTAATAATATTAATATTGTGTTTTGTACTTTGTACTTTGTACATGTA
TATATTATTTACATGTACAAAGTACAAAACAAGAACTGCGAGCATTAAAACGCCAGCAGTCTTTAACCTTTTGAAAATATTCCTTTTGCATTTCAGTTTA
GATTTAACCTAATTTGTTCTCTTAGAAATCCCAGTAACCGGTGTTGAGTGGCGTGAAAACTATCTTAACCAGCTAAAACAGATCTTATAAAAAAATTGTT
TCTGTTGACAATAAACAAAAAAACGTCGCTACAGAAGCTCATTTTTAAGCTACAATGTACTGCTTATGCAATATTGTTTTTAGCACATAGCTGGTCATTT
CTTTTAGACCACGGTGCCTCAACTTCTGGACGATTGTAGTAGTAGCCACAATAATCACCTAAGGGCAGAAACATTGGCCAAAAGGGTACGACGCAATCAC
TTACGCCGCGGTAATAATACTTGTTTAGTTCTTAATACCTTACATCTTTGCAGCGTGTTTCTTAGAGAAGTTTTACTCCAACCAAAATTGGTTGTCTTCG
GTCCGGGGTTGGAGCCTACCCTTTCTTTCACAAATAGCAAAGCCTTGCCTCAACGAGAGATGCAGCTTTGTTGGAGGAGTTTCTCTTGGCAGCACCTCCA
TTATTTCCGTTGTACTTTATTCTGTGGACCTTTTTGAATATGGTCATTAGTTTGGTCCTTAGTTTGACCTAAGTTTTGTGTGATGTATTTTTGGGTGCGA
CTATTCGCACAGTTTTCACTCACTTCCCCAGTTTTACTTTTTATTTTTATTTTTTTTTTCAAATTACGAGTCGTTTCAAACGCTAAGAAAAAAAACACAC
GAGTGAGACTCCCACTGCTCTCACTGTGAGGGCAAAGCCATAAAATCTGTGAAGGCTCTCCTTGTTTGGTTATCCCTACCCGACAGCGCGAAGCTTCAAG
ACGAAAAATCTTGACTGTGAATCGAGAAGAGAACGAAGGAAGAGCGACCAGGATTGGCTGGATAAAGCTTGTTCAAGTGTGTATGATAAAATACGTTTCG
TTATTTGACTTCCGTAGCTTTTCAAGGGTGTAGGATACAGGGATGCCG