Description :
From Genome Similarity Track
Location :
Scaffold_2707:1428- 3194
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2707-snap-gene-0.2Chloride Channel (ClC) Family

Sequence
1766 bases(100 bases per row)
TAGGCGTTGTTGAGCTTGAGCATGCGGAAGAGCAGGTCGACGCGCTTCATGGGCGTCATCTCCATCAACTGGAACGGCGACGGGTTGATCAACACCGTGA
GCTTGGTGCGCGGGCAGATCTCGTTCGTGCCCCAGTCCATGATCTTGCCGCCGCGGCGAAAGGCAAAGTGGATTGGCCAGTCCAGTAACTGCATGCCGCA
GTCGAACGCCTCGATGCCCGGGTACGGATTCAAAGCTTCGTCCGCCGCGCTGTCCAACACTATCGCGCCGTAGTTCGGCCTTGCGCCTGGCGACTGGTGT
TCGCTAGCTGGCGACGGCGCCGCCTTGAAGAGCAGCGAGGCCGTCGATGTGCCGCGCACCGCGAACTGCGGCACGGACAGGCCGCAGTCGCGCATCTTCT
TCTGGCAGTACTCGACCGTCGCGATGAGCCGCGCGCGCGTGACCGTAGCCAGCAGGAAGAGGTTCTCGCTCGAGTCCACGATCGGGTAGATGGGTTCGTT
CGACGTGCGCAGCACGCGCAGCGCGTCCGCGTAGGTCGAGTCGGCCGTGAGGTAGCGCGAGTCGTGCACGTCGCGCATGACCTCCCAGATCGGGATGTCG
TAGGCGGCCTTGGGCAGCTTCTTGAGCTGCGGCAGCTGGCTCGTGGTGATAAGCATGTCGTAGACGTTCTCAGAGAATCGCTTGGCCGTGAAGTAGGACG
CGAGGATCGCGACGGACACGGGCAGGTTGAGCCCGTCGTTGTGCGAGATCTCCATGATGATCACAGCCGTCGAGATCGCGTGCGTGACGCCCGACGAGAA
GGCCCCAGCGCCGATGATCGCATACTCGTAGGGCTGGTACTGCGTCTCGAACAGCTCGAATGCGTGGATGGCCTCGCCGATGAGCCGGCCGTAGATGCCG
CCGATCACGAACGTCGGCGTGAAGAGCCCCGCCGGGATGGGCAGGATCACACTCACGAGCGTGAGCACGTACTTGAGCGGCAGGTACGTGATGAGCGACC
GCGAGAGCAGCACGCTGTCCTCCTCGTTCTCGCCAGCGCCTCCGCCGCTCTTCGGACTCCCAGCCTCCGGGTGGCTGTTGACAAACGGCTTCTTGTCGGA
GAAGAGCGCCGCGAGGATCGTGCGCGGTGAGCCGTGGCGGATGAACCACGCGCTGTCACCGTAGAATTCAAGAAAGCACGAGACGAACGTAATGCTCACG
ACCAGCAGCAGGCGCTTGCCCAGGCCGCTGAGTAGCAACGCTTTGATCTTCCCCACGAGCGACGAGCCACTGGCCATGTCCACGATGGGCTCGGGGATCC
GGAAGAAGTGGTCGCGTGCGCGCACGAGCACGTAGATGCAGTAGTTAAAGAACGCGCCGCCAAGGCCACAGGTCACGCCGATGAGCGTGAACACGACCAG
GTCGCGGATCGTGACCGAGTGCAGGTCGTTCACGTCCGCGATGCCCAGGTTGGAGCTCCCGAAGAGTCCGTAGCGCGTGTTCTCGGTCACAAAGTTGACG
AACAGCGCGCCGACAATCGACGCGAAGAAGGACCGCGGCAGCGTGCGCACCATGTAGAAGTGCGACGTCACCTCGACGCCGAAGAGGATGCCGCCAAAGG
GCGAGCCGAAGGTAGCGGCCACGCCGGCAGCGCAGGCGCACGCGAGCATCTCCAGGCGCTTGGTCTCGTCGTTGCTGATCCGCTGGAATACCGGCAGGTT
CATGAGCAAGTTTGCAAAGCCGCACGAGATCATGATGAACGGGCCTTCCTTGCCGATCGAGAGCCC