Description :
From Genome Similarity Track
Location :
Scaffold_783:1428- 3085
Sequence
1657 bases(100 bases per row)
AATTGCGATTGCATATTGTGAATGACGACTCGCCGTCGGAGAAAGCTCCTGCTCACTTGGGGGGGGGTTACTGTCATTCGGCATGTTTGTGTTTGCGTGG
CACGTCGGTGGATGGTTGGTTTATAATCGACCGTAGAGTTGCCGTCGTCGGAATTGCCGGACCCAATGTCTGCTTGCTTGTATGCACGAGGTACATGTTG
TAATCGCTACACCCCTGCTCAGATTAACTGTGTAGTTGTGCCATGTACAAGTCCAACACAATGATTGGTATCAAGATCTTATAAGTAGTGGCTTGGTTGC
AGCCATTACAGTGTACCGCCAAGCGGTATGGCAAGATGTGGTATTCCGACGGCGACGAGGTAATTTTTTAACAACGCATAACGCGATAATGAGATACTTG
TTAAACACGCCGGAAGATAGGCTTCCCACGTTGTTGCCTGTGAAAATGGCATTGgtcttgcagctgcaacaacgaAAAGGCTTCATACGGGTACCATAAT
TGGTCAAAGCTGACGAGTAGAAATTGCTCCCATTTAAAATTGTGATTGGGTATATATTTATATTAAAAAGTAAAATAATAATACCCATATCTATATTTAA
AATAAAGTTAAATCTAGTAAAAATAGTACCCAATCACAACTTAAAATGGGATCAATTTTTAGTAGTTACGGGACCAAAGCCGAAGTCAACATTGTAAGTG
CCAGTCGGTTGGTATGTGATTTACTGCATGTACTGGTCGGAACTTGTGACATTGGTGCGGAAGGAGACAAAATCACAATTGACTTCCCTTCCATCCGTGA
GTGCATCGCAAGGAATTTTCGGTAAAGAATATTTTCAATTTCGTCCACtacatcctcatcatcagGATCATCTTCGCCGTGACAGCGCCATCGTCTCGAT
CTTCCATTTGGAGTGCCGCACAGTTTCCAACTCCAACGGATTTACCCTGGCGACTGTGCGGGAATTCACCACACTGTCGCACAACGTGGTGAAGGTGGCT
CTGTTGCGTTCAACCAGTCGTATTGATAACTTCAAGATCGGACAGTTCGTCTATCCGAATTCCTCACCATCAGTTCGTCCCCTCGCGCCACTTCCAACAC
GCTCTCGATTATGCTTAAGTCTATCGGTGACTTGACGATTCAGCTTGTCATTTACTCGGAAGACTGCAAGAGGAACAATGCCTTACCCGCAGTCTACCTG
GAAAGCTACTACTGCGTCACTAGAAATGTACGGCGTGAACTCGGCCGTGCCTCTCGTGGGTGGCGGCATTCGTATCACACCATTGTTCGCCACCTTGAGA
GACAGCTCCAACAGAGCGAGCCGCTGCACCCAGAAGGTGTTCCTTATAATTATACTTCGTGAGACGTCGctactggagaagatcatTTGCTACTGATGCG
GGTCAAGGAGCTCGAACTACAAGAGTAATACTTCAGCCTGCACTTCAGTCACGCGCTCACTTACTAATGAACAACTGGCCTAGCAGCCATTTGATGACTG
TACCATGGATACGAAGCTGGGTGTTCAACGCTCGCTCACGCAGTTAGTGACGTTGATCACTGGTTCACACGACAGCATAATGAGGATCTTTTGGGATCCG
GGATCATACCAGTGTAAGGTGATCTCACATCTTCAGCgtgaagagcaggagcactgc