Description :
From Genome Similarity Track
Location :
Scaffold_388:1428- 2759
Sequence
1331 bases(100 bases per row)
CTGCCCTCACTGTCTGCTCTCCTGGAGCTGGACGAGATGTTCTTGGCCGAGTTCGGCGAAGCTTTGAAGGCTGGAGATTTGGCTGAGGTAGTGGTCATAC
GACCCGAAGAAGAGTTGAACTCGTCCTCGCTTCTGGATGAAGCTATCCTGGAAGACATCAAGAAGGCGCTGAATGCGCGGAGCGGATCGGCGATCCTGAA
GGACCCGTCGGATCCCCTGTATCAAGTGGTAAAGGATTACCAGGACGTGGTCTCGAAGGAGCCGCCCTCGGGGCTACCTCCGGATCGAGGTATTCGACAC
GAAATCGATCTCGTTCCGGGAACGAAGTACTGCGTGACGAGGCAGTGGCCCTTCTACAGTGTGACGTCATTGACGCGTTCTTCCGTGCGAAGCATGAGGC
GGGCATGGTGCGTGAGAGTAAGTCTCCACACTCTACGCCGACGTTCTGTGTCAAAGCCGAATGGCAAGTGGCGTATCGTGCATGCTTTCAACAAGCTGAA
TACCGCTACCATTCCGACGCAGACGCCGATTCCTCGGAAGGATGTTCTTCAGAACAACATGACAGGATGTACGATGTACAGTGCGCTCGACTTGGTTGAT
GGATATTACCAATTGCTCATGAGGACGAGCGACATTCCTCTCCCTGCGGTGAGTACTCCGAGCGGCATGCTCTGGGAGTGGTTGGTGATGCCCCAAGGGC
TTTCGACCCCACCCGCGACGTTTAATCGTCTTGTGACGCAGCTCTTCAGGCCCCATCGGGCGTACGCGCAAACGTACTTCGATGACATCTTTGTCCACAG
TCGTGCGGAGCACGGAAAGACTGATATGGAGAACCATGCGGAGCACCTGCGTGCTGTGCTCGAATGCATGCGTTAAAACAAGCTGTACGCCAACATTGAC
AAATGCATCTTCGGAGCGGAAGAGATCCCCTTCTTAGGGTGCTTCATCGGGAAGCGTGGCCAGAGGGCCGACCCGGTCAAGGTCAAGGTCATTGTTGACT
GGCCGGTTCCCAAGAACCAGAAGGATCTTCGCAAGTGGCTTGGCTTGGCCAATTACTTGCACAAGTACAGCGAGAACTACGCTGAGATGGCTCGGCCACT
CTCCAATCTCCTAAAGAAGGATGCGGAGTGGTGTTGGGACACCGAGCATCAAGATGCGTTTGCGGCAATTAAGGACAGTCTCCTTCATGCGCCTATTCTG
GCTTTGCCAGACCCCGCTCGTCCGTTTAGTGTCGTCTATGACGCCTCGGACTTTGCCATCGGCTGTGCCCTGCTGCAAGCAGACGCCGAGGGGCGCGAGC
GCGTGGTGGCGTTCGAATCTCGCCAGCTGAA