Description :
From Genome Similarity Track
Location :
Scaffold_3544:1428- 2591
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3544-fgenesh-gene-0.0Conserved gene of unknown function

Sequence
1163 bases(100 bases per row)
GCGGCGCTGGCGAGTGCAGTACCAGCTCTCGCCAGCGACCGAGAGTTTCCTGTTGCCAGCAGACCACACGAACGTTTTTCGTGTGCTGGTCACAGAGGCG
CTCGTCACGTGGGTCGCGACCACGGCGCTTGTGTTCAGTTTCCTCCCTCCAAAGCAACGTCATGAAGAGGAGAAGGAAGAAGGCGATGGGGACGAGAAAC
CGTCGCTTGTGGAGAAGACACCTCCGCCCGTTACGATCTCCACGCCGTACGTATCGACGGAAGAAGCAGAAGCCACGAGACGACTGACCGAGGCGGCTGC
AACTGCCGCCCACGAGGCTGCAGAGGCCGCGCGCGAGGCCGCACGCGCTGCGACACACGCGATGGAAGAGGCCAAGACGCTGCACGAGGAGCATGGGCAG
CTACAGCAGCAACAACAGCAAAAGTACGAGCGCGAGCGTGCGAGAGAGTTAGAAGCGGAGAGACAACGCGCGCACGCCCGCTTGGACGCCGACGCCAAAG
AGAATGCCCGAGAGGCCGAGCACGCTCTGGCAAAGCAGCAGCTGCAACACGAATTGGAGCGACTGAGCGACGAGAAGCAGCAGCTGCGGGACGGCGCTGA
GCGACTGACGCGCGAGCTGCAAGATAAAGGGGCGGCCATGGAGCAGTGGACGCAGCAGACTGCGACCACGGCCGCTGCGATTGAGGTGCGTCGTATGGGA
GCAACTAATCAATGGATGGAGAAGCTTATTGATGGTACATATGCAGCTCTTGAAGCAGCGGGTCGATGCCGATGCACGTGAGCGTGATGAGCTCCAGCGG
CGACTGCGCGTGCTGGAAGCGGAGAAGCTCGAGCTGCAGCAGAAGAGCCGCGCCTGCGTCGTCCAGTGACGTTGGCATATGGCGTTCGCGTCCCCAGGTG
TAGGAAGAGGACGACTACTTGGTTTCTTTGCCGACTCCTGGCTTGCGTGTGATGGCTGCGAGTAGCTTGCTGTCGCGCTGCAGCAACGCGTAGACGCGCA
GCGCCGCGTGGCCGTCGGCGACAAACGACGCGATCTTTTGCGCGTCACGTTCGTCGCGTCGTAGGCGAATGAGTTCGCGCGCGTTGAAGAGCAGCTTCTT
GGCGATGCTGCGGTCCGGGAACGCGCGCGCCGTGCGCACGACCGCACGGTAGAGCGAGAGCAC