Description :
From Genome Similarity Track
Location :
Scaffold_32:142794- 144341
Transcript NameFunction/comments
g6877.t1OWZ11175.1 hypothetical protein PHMEG_00015843 [Phytophthora megakarya

Sequence
1547 bases(100 bases per row)
AACTACAATACTCCACTAACCTTAGACAAAGAGCGATGTCTCTGTTGTATCAGATTGCGAAGAGGTCGAAAACGCTTTGTAAGCTCGATAACCCGTAGTT
TGGTCCCTAGCAGCTACCTTTGCGTCACACGTGATAGCCTTGCTAATACATTTGGAGCAGAAGGAAATCTTGTGCTGAGTTAGCCGGCCGTCCAGCTCAA
TAAAGCTGATGCGTCTGCTGATCTTGCACGAGTAGCACACGCAGCCATAGCACAGCTTGCACGTACGCGAGCCAATGGCACCTCTAATTCCAGAAGCTGT
CTTGCGATCGCACATCACACACCTCCCTTGGATTTCATGTTTGGAAACTGAGTTCTGCTGCTGCAGCATCCACGATAGTTTCTTCATCTGTCCGCAATAT
ACCAGCTTGGTTGAAAAAAACAGAGCATCCGCAGCTACTTTGACTGAGAAGAAGCGCATAACGTCTCCTCCGGGGGCTATGGTATTGGACGCATACATGT
CGATAGCATTGCGATCAAGTTGGCGGTAGCAGCCGAAGTACGAAAAGTTTCCGCGAATGGCGCCAGGCAGTGGCTTAGTTTGGGGAAAGTCAATGGAATG
GAGTAACTGGTACCCGACCCGATTACCATCAGCGAGCTGTACGATGCCCGTTGACTCCATGAAGACAAAGTCACGGGCCTTGACAATACTCGTGGATTGC
AGCGGCACATCAATCGTCATCCATTTAATGGCGAGCGAACGAAATGGGTCGTCCTCGGTTGGTTCCAGTAGTGTGTGCAGTATCGCAGCACTGTCAAAGT
CGTGAACGTACGAAGCCTTGATTCGCATGGTGTCCAAAGTCGGATTTACAACACCGAACATGAGGTCGTCAAGCTCACCGACAAGTGTCCCGACACTCAT
TACCACCGGTACGTTTTCCAAGGTTTGGGTCGCGCTTGCTGTGTTTCCGGGTATGGCGGTCTTGCGATCGAATTCTTTTAGCCGTCGTTCTGCGTACGCA
TGCTGGTTGCCTTTGGACTTGACGTATTTCCACCGCTTGTCATCGATCTGGCGCTTGTCGACGACGACGAAGTCCTCGTACTTCTGGTATCCGTCCTGCA
CAAACGCGTCGGCGAGCTCAATCAGCTGCTTGCGCTCTTCTTCGGACACGCGAAGGCCTGAGTAGGGGGTTACGGCGAACCGGTCCTTCGGCATGGTTGG
ATTGCCCCCGCCGTAACAAATCGACAACTGAATCGAGGCCTAGCGTGCGATGGTACGGCGACTTGCCGTAACTCTTCCCATCATGAGGAGATTTGTCCCG
TATGTATTGGTACAGCAAGGTGAATCCAGAATACACTGCCGTAAACTTGTGCTTTGGAAGCGCCTATCGGGTTGAGCAAGAGGAACCAGGAAGTTGCTAA
CGTTGGGCCCGTGGATTATACACGTAAAATGCTATTGGTATCAAATGGATGCAGCGATAAAGTCCTGCTACATTTCTCTAGTATCTTCGGAGACGAAAGC
ATGTAGACGACTTTGACGTGGTGTCCAAGTCGAAAGCATCCTGCAAG