Description :
From Genome Similarity Track
Location :
Scaffold_98:14276- 18639
Transcript NameFunction/comments
Phyci_12390Hypothetical protein
Phyci_95604Hypothetical protein
Phyci_591441Hypothetical protein

Sequence
4363 bases(100 bases per row)
caaccagagccggcaaacgtcgccatggaatccgtcagttcacattccacgtcgggatcggaaccccgacgagatgtggacgaagaccctgacaacttgt
ttgacttaaatatcagggtgcccggacataccgccgcggtctcaaccgcggcggctggcgcaggcctcatctctcatcgtcttcagatctgaaggggttt
ctgggacgagatgcccgcgaggagaaggcccgggcatggctcaaccgcttgaaatctgcagctcgctgcgacggaacgggagaagaaatttgcgggctat
ccagcgatctgatgaacgatccagcacgccaatggcgcctccagcttcaatagaaggtcaacaaatcatgcacggaactgatggaaaaatttcgtatcca
gtaggggcgtcgatggcgagtcgttactaccacgcgatgcaacgtcccgacgcgaccccgctggattacttgtaccggctcacgtcgccggtctgcgagc
caatatcccaacgctgatggcacagcggaagaaaagcgagaacacatcgatcattacgtcaagacgttgagcactcaggaacaggaactcgcctcacggc
tcactatgatggaggtcccggattctgtcgcactggagaagtagctgcgcgcacgacaacgtgggctggcccaccataagaagacgctcttcggctcgag
caagttccgtcagaaggcacctgcgtcgtcaccccagccggctcgagcggtccatgcgattcgagtcacgccggacgaatacgactcagaacatgatagt
cacaacggcgacgaccgcatgtacgaccaggacgaagaagaagaggagcgagccaaactgtcactgggcaagcgccaaccgccgaggcaacgcgtcgcaa
cttcgattcggaagactcgggacgcgaccgtccgcgataccgtcacgtcgccacgacgatggagactgctgacgcctgttgatgtgccagaaatggggag
gccaccatccgacggaccgatgcttgaaattgtgcaatgcttgtggtgatgtgcatgacgccggacaatgcccgtccgaggaattcatcaaccagctccc
tcagaggtttgacccgcacaaacgcgcggggacgttgcccctgacagccgagaagatgttaaactgggtcgctcgctggcctggaaaccagtacgagacg
agcgacctgtttccgtctatgcatatgaggccaaaacgtcgcaagaggtggttagtgagagcccgacttccctgaatgataatacatgtgaatccaatct
ggaacgtaccacgcgagaacgcgcaccccaagtttcagctatcAGACTTACGACGGACGGCGAGTTCGCGCGGGACATCCCCCCCCCCTGGACGAgatag
acatgcaactaggagggcgacgcggatactggaaacactatgcgccgcacaagtggtgcaaacatgccaagattcacgggaagttggacaatcgctgcgc
ggtgttgttgcttgatacaagagccgaggtgaccattctggacaccacatttgctcgtgcgggaggctgccggatcgacacggacatcacgcaagagtgt
gtgggaatgcgcgatgagacatattacacagtggggagagcgagggtcaagattaccttggccgggaatctggtgtactacatgcacctttgggttggag
ccttggctggtcagcacgcaatcttgggggtgaacttcatggtgccgtctggagtgcgcattgacactgcggacgatacggcgtgcctccccgacgaggt
gcacattcagatgatcggaaggagaccgctatacggcgcacggatgcacccggtgaacgttaagacgcctgtgaggctgaatccgggaaggtcctgcttc
gaccagatcggaacacaccgctcctgtgggtaacgcgaagagagtcatgggtcaccacgtttatgaagggcacggttgggcgaagaacatacctgtgcgt
gatgaacgtcggagactctgggataactggatgcccacaagaccctggcgtggtggcgccgactggcgtccttccacgagcgcgaggttttgttcaattg
gagtcccgccgttaccaagattggcagaatctggcttatggcgcgacgtgcaacgcagacgagaagtgggttcctgtcaagatcgacgggccgatggtca
aatgccctattatccccgattctgcgttcgaaatcgaagccggaaggcgaacagcccgatgggcgacaactaccggcctcactgctgactgccgtcgcca
tagccccgaataaccagcgccaagaccgctgctcgagagaggcttcaaggaatcggcccgaggggaaccagaaacgcaacccgacaccttgctagtcgtg
acgggataagctgggacaagaaatgtcgagaaggaagtaatgtcggagccagaacaggcaaccgcgtcggacaccggtattgatccaggaaggatccgac
cacttctctgaacatctcggaaatggccgtgctgccggacctctcgttgactgccgaggtgaagatcgaagacctgaaagtcggaacgcccgacggagag
gcgtccggagaagccgcacagcaagaaaatcgactgcgtcagaccatctggaagagacggaagtGGCtgatcggaaaggaaatgccctgccgcccgcggc
cgtaggcatcgtttgcgatatcgacgtgggtgaaaaccatagctacacgcgttcggaaaatcccgccgcaattcagagagaatgtgtcggagttgatcaa
gggactcctcaacgcgggcatgacccaaacgaagtcaccaccaatcctcgtgagtgtgaagcaaaacggcgtcgtcatctggctctgcatcgactatgga
ctagtcaacggactcacgcaactgatgatctatttcataccactcgtcaatgacgtgttgaaaactcggacaagtacctgtggtactgctccctcgacaa
ggccagcaggttctgggtcgtccctatgactgaccgagcccggctcatctcggccttcatcacaccgatgggtttgtacgaatggctgcgggtgcccttc
ggcctctgcaacgtgccgcaaatataccagacttctggacaatgctctccgtgagctcttGAAGCTGCCTTCGGACGGTATTACCCCGGACGTCTTCGAA
GAGAAACCAGAAGCCCCAGGGATCCACTCCGTCTTGGGGTGGAGATCCTACATCGACGACATTCTGATTGGCGGTACGTCGTGGGACGACCTGTGCGAAA
ACGTCGAGCGACTGCTTGATGTCTGTGAGCGGTGGCACTTGTCCATCAGCGTTGAAAGAGTGAGTGGGGCATGTCCCcgggccgactacctgggcctcaa
agtgtcggagcatggcctccgggcgaagcccaagaacctcgaatcactgacgacgttggagtttccacgcacgttcacgggcctgcagtcgttccttggt
agtcttaattgtaccaccgattcatcgccaacttcgcGCGACCAACAGAAGTGGATCCATGCGATGCGTGCCTTTGACGCAATCAAAACAAAATTTGCCG
AGACCCCgatgttgaagcacttcgacgcgagtcgagggcccgtcgccatcgtatattccagcgcctgggccatctcaggtgtactcgtgtatgccggtga
agttcgtcagccccacaccgaagcctaacgagttgaataacagcgtcatcgagaagaaagcttggccctgttgcgcgccctgagtgaatgcgatacgatt
ttggccgccgggtcttgacccgccatacgacgcgcgcttggttgattcgatccaagggactccaaggccgactctcacagtgggccgccgtcctctcgcc
gtggaggctctagatcagtcgttccacgaagggataagatgagatcttggtactatggccgcaagtatcacaccccgagcgttcatcgataccgctctgg
aggaaatccaaccgcgaagatgcgcgccgaaggtagtcgtcatcccggtcccagttgtgacacgcgacgaagagctccacgtcatgagtatcgacggctc
agccaaggctaaacgggaaggcggtgcattcagcgcagttgtcaggaagttgcctgggtgggaggttgtgcaagcggcatccggctacgcgacggacctc
accgtcaacgaggccgagtatcggggattgctcctcggatgatcacttctggaaggaatggatgagattgcctggctggtggtatgcggtgactccaact
tggttatccgacagatgcgggatgagatggagtgcaagtcatcggggttgaaacttctacgCC