Description :
From Genome Similarity Track
Location :
Scaffold_57:142756- 144058
Sequence
1302 bases(100 bases per row)
GTTTGGCCAACTACCTTCACAAGTACAGTGCAGGATACGCGGGCTTCGCTAATTCCTTGTCGGGTCTCCTTCAGAAGGACATCGACTGGCGCTGGGAGCA
AGAGCACCAGGATGTCTTTGACAGCATCAAGGCCCAGTCTGCAAGATGCCCCTGCCGAACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGACT
ATGCCATCGGGTGTGCACTGCTGCAGGTCGACACGGCTGGACATGAACGAGTCATCTTGTTCCAGTCCAGGCAGCTCAAAGCTGCCCAACGGAATTACCC
TGTCCACGACAAGGAGCTCCTGGTAATATAGAATGCCCTTGTGAAGTTTGGGCTCACCTTCTGGGCGCACGGCCCTTCGTGATCTACACAGACCAAGCAT
CCTTGAGGACGGCGACAAATTCGCCTCACCTCTCCCAACGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAGTACAACGTCCGCGTCAAGTACAGGCCGGG
CAAACTCAACGTGCTTGCGGGCGCCCTCGCTCAGCGTCCAGACTATGAACCTCCACGGGTGGTCGTACCCAACGACGAGAATCTGAAGTTCGACATCCTC
GCGGAGGCGCACGACGCGCCCTCCAGCGGCCACTTGGGTTGCGAGAAGACCTTCCTGTCGATCGCTCAGGCCTTCAGGTGGACCCACATGAACAAGTGGG
TCGCCCGATACGTGAAGACATGTGAAACATGTCAGCGGGTCAAATCCGCAGGGCACGCTTCGGCTGCACTACAGAGCCTGCCCGTTCCAGCTGCCTGTTG
GAAGTCGATGAGTCTTGTCTTCATCTTTGGGCATTCCGCCGACGGACACGGCAACACCGGAATTTTGGTTTCGTGTGTCGGCTGAACAAGATGGTACATC
TCGCTCCAGTACACGTTACAGTCACAGGCGAACAAACCGCGAGGTTGCTCGCCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGAAGACTGTCTCGGA
CCGAGACCCGCGATTCACGGCCGCGTTTTGAAAAACGCTGTTTCCTTTACTGAGAACTCGTCTGCAGATGTCGACTGCGAACCATTCACAGACGGACGGC
CAGACGGAGCGCGTCAATCGAGTGCTTGAGGACACTCTGTGCAGTGTGTGCGCGAAAGCACCACGCACGTGGTCGACGCAGCTTCCTGTAGTTGATTTTG
CGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCATTCTAGTTGAACGGCTTCCGTCACCCCAGAGTGTCTCTCACTCTTCGAGGGGACACTGT
GG