Description :
From Genome Similarity Track
Location :
Scaffold_193:14274- 19103
Transcript NameFunction/comments
Hyaar_Emoy2812304fructokinase, putative
Hyaar_Emoy2812305hypothetical protein

Sequence
4829 bases(100 bases per row)
CACGAAGTATGTTTCTCCTGACCACATCTCTAGGGTCGCAGTGATTTTTCTAGTTTGTCATCCCCGGCTGCTAGTTCGGTGACGAATTCGTGTACTATTG
TGTTTGTGTCGTATTGGTTTGTAAGTAAATCCATAGATAGCTTTCCGACCCAGTCAAGCACAAGTAAACTGATACATCCCTTCGATTGAGGATGCTAATA
AGGAAGCGGTCTTGTGCAGACTTTGTCTGGTTAATAAACATGAATTCGACCACAAGACGAACGGATTGCTATAATGACGAGATTCATGTGTCGTCGCTTC
GGTCTCAGGCAGATTCCGTGTTGAACGGACTTGTTCTATAGCCGTTCGAAACTTCGAGGAGGGCAAGGGTAATCCATGCCTTCACTTACCGTAAAGATAC
TAAGGCGTGATCAGGTTGATAGCGTGGTTTTTTGGTAAGGGCTTTACTATGTTGTAGCGACTCTTACGAATACACACCCGCATACAGTAGGACCTAAGGT
GACCGTGCAACTTACACAAGCCAATTACAAATGCAAACTCTGGTGTAATATTACATACAGGATGTGGCTGGGTGTACCCCCTTCTTTTGTTCAGCAAACA
TTCCTCATTCAATTACGGCAGCAACTCTTCATGAGTACAGAGTCAAGAGAACGTATTTTTAGTGATGAGGGCTTCGTCCAGATAATGTTTTTGACTCGGT
GCTAAGGATGCTATCCAGCTTTGTTGGTAAAAAGCGCTGTATATACATCGTACGGCAAAGTGTGGTACTAGGTTTGGGCTGTCGTACAGCTTCGCCTCCA
GAGTTCTGCTGTCGCTCTCAATTGTTGTGTGTGCACCGCTTTTCATGTCCCCATGATCTTCCTTTTCTAGTCTGCGCATTCTGACGGAGTCAAGTCGCAG
ATCTTCTTTTGTCCTTCAAAAACAGGCTTTGGACCGCCTCCATTGTTCCTTTTTAGTTAGCTCGGTCGCACTGCGTTCTCATCACCACTTGCGTACTGTA
ACAGCATCCAAGTTCCATTCAGGGGTCCAAAAGTGCGTCGCAGCTCATTAGAACACCCCACCCTCACTGGCGATCTGTCCTTTACCTCCTAATATCAATC
GAAGCAAGTCATTGATAAACCAAGCAATAGCCTGTCCTGGTGATGGTTGCGATAAACCTACCTACGTGCTCCTCAGACATGTGTCAACGATTACGCAGTC
CTCAAAGTATCTAAAATGACACCGAACTTCTAATATGCGTCGGGCTTGTGTAATTTGGTCGGCCACTAATGATACATGCGAGCTTCTAATCGATGAGAAT
CAGTATAGCGGAGTGTGGCACTAGCTAAAGGATGTGAGCGCCGTCATGTCCAAAAATAACTGCTACTTTTAGGAACGGCTTGTCCGACACATTCTGTCTA
CTTTTGCTGTAAGTCAAGCGCGATACTGAATTCTATGATGACCAGCAACGTGAGGAGTTGTGTTAGAAGATATCGTCTCTGACAGGTGATGGCGTTTCCG
GCATAGACTGCAAGGCCTGTTACTAGTGAAGGGCGACTTCACCTGATCAGCTGACAAGTTGATAGGTGGGACGAAGACGAGACAAGTCGACATATGGGAC
GAGAGAAGACGATCGTCATGTCGGACTATCGAGGCAGATGGTAGGTGAGACAGCGACATACTGACGTCATGTGGGACCAGAACCAGCACACATGGTGATG
GGCACGCTTGATGTGTGCCAAGTGTAACTTGACCAGGTCAAGTTGCAGTGCTGGTGCAATGCATATAATAGGGTTGACTAGAGAGAATAGTTAACACTCA
ATATATTTCATTTTTACTTCCTACATCTTCTGCAAAAGTGCAGATAAACACACTACAGTCTAACAGGAGTAGCACCCTGAAATACTATTGGCGAGTAACG
AGAGCAACGGCTCGTCACAATAAAATACAAGGTGAAGCTTTCTAAGAAATATCATATAAAGCTGTGTGCTACTTGCGCTAAACACTTATCAGTTTATCGT
TGAACGTAGAATCAAACAGTGTCGATGTATACTAAAAATACACCTTGACTGCTTCAAATGCCATCATCCCTGCGATCGCTCCCCCCGCACAATCAGAATA
CAGAATAGTCAGCTTCTGCTCGTCTTCATACAGATACGTTTATTAGATATGATCGTATGCTTGCTCCACAAGAATTAACAACCCCAGAAGGCCGAAGCAG
CACATCGCACGATCAGCTTTAGGTATAGAAGTCAAAACCAATCATCACATACGACCTATTAGATCTATCACTACACAACAGCATCAACTCTTCTGGTCGA
TTGCGTACAGAACCTCTTTTCCTTACTATCAAAGCACAGATCAGATCGATGCAAAGAAACGCACGAACGTCAAATATCTGGATGCATTGCATTCCCAATC
ACCAGGTACTACATACACCACTTAACAGACTTGAACAGGGCCTCTTGCCTTCCTTGCTCCTATCTGACTGCTACCTTCTACTTCAAACGAGGGAGGACTA
GACGCCACACGACAGAAGGGTCTGGTTTGCAATCACTTGTGCTGCTCGAGTTCCAGACGAGCCAAATGCAAGGAGCTCACAAGGCCAATCGCCGAGTGGA
ACGATGCTCGGATGTACTTGTCCACGGGCGGCTGTTGGCCGTACTGGTTGACTCGCGCGACAAACTTTTCCCGGATCAAGTGGAACAACTTCTCCCGACG
AGCAATGCCCCCACCTATAACAATCACATCCGGAGACGTAAGGAACGTCACATTGAGACACAAATTGGCCAAGTAATGGGCGATCGTGTCCCATACGGGA
TCGTCGTCCGTGATCGAGGCCAGATCACGCCGGTCGACGCCCGTACGCGCTGCAATGGAGCCCGAGGCCACCATGCCTTCGACACAGTTGCCGTGGAAGG
GACACACGCCTTTGAAGTCCGTCTCGATGTCTTGTGGAGCAGGGGGTACAATGATATGACCCCCTTCAGGGTGCATGAAGCCGTGGATGGCGTTGCCATT
CGTGCACACGCCGACACCAACTCCAGTGCCCACTGTGATGTACACGGCGCTGCTAATGTCTCCGTGGCCGCCGTACGCTACTTCATAGAGTGCGGGAGCG
TTCACGTCCGTGTCAAAGCCAATAGGGATGTTAGGGAACGCACGCTCGAACACGCCGACAACTTCAGTGTTCCCCCAATTGGGCTTGGGCGTACTCGTGA
TATAGCCGTACGTCGGGGACTTTCTGTTCAGGTCCACGGGTCCGAACGACGCAATCCCGATCGCGTCGAACGTGCGCTCCTTGAGCCAATCGATGATGGC
GCCCATAGTCTCATCAGGTGTCGTCGTGTCCACCTCGAACTTCTCCAGGATGTTCTCGGGATGATCCTCAGCAATGGCCGCTACCCACGTCGTGCCACCA
ACTTCTACGCCTGCGTATCGAGTCATTTTGATATTGGATGGAGAGAGAGTGAGACGTCGACTTGTGTGGTTTGTGGAAAATCTCAAAGTGAGAGAGAGTT
GGGGTAGCGGCGATGGTGGGTTTTGTATTGCTTGGTATCGGGGATTGTTTCTACGGTTAGAAAGACGCGAGTGCAAGTCATCCCTCCTCGGTCCCTGCTT
GGGAACATCAACCAGCTGGTATACGAAGTGAGCTCTTCGTGCGGTCAAGATGGGAGTGCCAGCTGAAGGTAGCAAGGACACGCCAAGACAACAGGGCGAC
TGCGACTAGGCTGCTTCCACGTCTGCGATCCACGATAGAGGGACTGCAACTCAGATCGCTCGAGATGATACGGTACGCAGCTTTTGAAGTTCCGGCCTAG
AGTGCTTGCTCGACTGGTAAGCAGACCCCTTGAAGTTCACGCAGTTCGAAACTCCCGTCGCGCAAGTGGATCAGGTTGCACCAGCTAGAGAGATCTCATT
CTGTATCGAGCGAGACAGAGTCGAGGTGCGTACACTACGTCACGCTTTGATTCTATCCACCTACGAGCTGACACTTTCGAGTTCGATACTAATGACATCC
GCTATCTGATGTTACACATGTGTGAACACGTCCTCGATCGGGCTATAGCTACTAGCTCTATCAACGCTTGCAATGTCCCTCTCTCGCTTGATGCAGTGCT
AGCAAAAGACACGGCGCAATCCATTCTCAATCCAAATCCATTGGCTCTCCCTGCAGTATAAGCGTCAACGCTTCGATATGTCCGTACATCGGGTATTGCT
TGGATGCACATGCTTGTCGCTTTTGCACGGTCTTTTCCTATTGAAGTTACGACCGGTTTAGGAGTGCATAGAAACGCCGCGAGTACGTTCAAGGATCGTT
CGAAACTCATGATACAAAAACGGGCTGATATAGTCAGGTGGACGATCTCTAACAACCTGAACGACAGTATGACTCGAGGTAGGGCGTGTAGATTTGTACC
GTAACCTGGGAGGTCAGATAAGCTTAGCACGCCCACCAAGAAAACAAGGCATATGAGTATACAGAAGGATATACCCCTGACGATCAGCTCGGGGGCTGGA
ATGATCCAAAATTTCAATAGATAGTGCAGCAAAAAAAGTCTGATCACTTGATGGTTGGCTGGCTGTACTTGTGAATGGATCGTCATCCATCTGATCTTGT
CCACTACTTTGGTGCTGCTTGTGAATGACAACGACTTGTATTCCAACGACAGCTCGTGATTTTTTCACAGCATCTATATCGCTATCTCTATAACAGGTAT
AACATGTTGCTCTTAAGAACATATAGCACGATAGAGGAACCTATTGATCACGGCCCAGTGCTCTCCAAGCCCGATCTTTAGTATCTGCAACTCAGCCTCG
TCGGCTCTACGCAAGAACAATCAACCACT