Description :
From Genome Similarity Track
Location :
Scaffold_17:14273- 15916
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_17-snap-gene-0.38Succinate semialdehyde dehydrogenase, mitochondrial

Sequence
1643 bases(100 bases per row)
TACTCGAGCCCGCCCATGCAAATGAGCTTGGTCTCAATGTACTCATCCATGCCGAGAAGCGAGCCCTCACGACCGAGTCCAGACTGCTTGATGCCTCCAA
ATGGGGCCTGCACGTTCGAGATCAGGCCCGTGTTGACGCCGACCATGCCTACTTCCATCTCGCCTGCAACACGCCACACACGCGAGAGGTCTCGCGAGTA
AAAGTAGCCAGCAAGGCCTGCTTCCGTATCATTCGCCTTCGCGATGACTTCCGCTTCGTCCTTGAACTTTAAGAGAGGCACAACAGGGCCGAAAATCTCC
TCCGTAGCCACACGCATCGTGCCGTTCACATCAATGAGCACGGTAGGCTCGTAGTAGTTCGGTCCCACAGTCGCTGCGGGGCGTCCACCAGTGATCGCCT
GGGCTCCCTTCGCAATCGCATCATCCACCAGCTCGTTAATCTTCTGGAAGGCACCAGGGCTAATAAGTGGCCCAACCTGAACACCCGATGCGCGAGGCTT
GCCGATCTTGAGCTTCTTGACACGATCGATAAACTTCTCGGTAAATCGCTCGTAGATGGCCTCCTGCACGAACACGCGGTTGCTGCACACGCACGTCTGG
CCCGTGTTGCGGAACTTCGATGCCATGAGGCCGTCGACAGCAGCGTCAATGTCTGCGTCGTCGAACACAATGAAAGGCGCATTACCACCGAGCTCCAGCG
AGAGACGCTTGACGTTGCTCGCCGACTGTTGCATGAGCAGCTTGCCAACACGGGTCGAGCCCGTGAATGACAGCTTACGCACGTCGTTGCTCAGCGACAG
CGCCTCGCCGACTTCGGCAGCACGCTCGACTGGAGACGTCACGACGTTGATCACACCCGACGGAATGCCAACGTCCTGCGCCAGCTTGGCgAGCGCCAAT
GCCGACAGCGGCGTCTCGGCAGCTGGCTTAATCACAGCCGTGCAACCAGCAGCAAGGAGCGGTCCGAGCTTACGCGTAATCATGGCAAGAGGGAAGTTCC
ACGGCGTGATGATGCCACACACACCGACTGGCTCCTTGACGGCCATGATCTTctgACCAAGTGCACTCGgtggCACAAcaaNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAACCCAGCGGCGTA
CGCGACCTCGCCCTTGGCCTCTAGCAACGGCTTGCCGCACTCCGCTGAGGCGATCACGGCGAGGTCGTCCGTGTGCTGGCGGATGGCCTCGTGCCACTTC
TTGAGCAGCGTCGAGCGTACATGCGGTGTGGTCTTCTTCCAGCTCTTCTGCGCTTGCTTGGCCGCTTCAATCGCGTCGAGCGTCTCCTGCTTGCCCATGC
TCGGCACGCGCGCAATCTCCAGGTCCGTGGACGGGTCGATCACAGAGAAGTGCGACTCATCGGCGGCTTCGACCCATTTGCCATCGATGAAGCCCTGCGT
GCGGATAAGCTCGGTATTGCCCACTTCCGAGTGGAACTGCGCGAGGCGGCCCACACGGACTGACGCAGGACGCACAGCCGAGCGGACGAGAGTCGAGGGG
CGgTGCAGCATCGTGGAGAAAGAGCAGGCGGATGTGCGGGGCG