Description :
From Genome Similarity Track
Location :
Scaffold_197:14270- 25356
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_197-fgenesh-gene-0.4Myotubularin
Pytar_ATCC12531maker-par_contig_197-snap-gene-0.16FtsJ methyltransferase domain-containing protein
Pytar_ATCC12531fgenesh_masked-par_contig_197-abinit-gene-0.40Isoform B of Splicing factor U2AF 65 kDa subunit
Pytar_ATCC12531maker-par_contig_197-snap-gene-0.21Myotubularin

Sequence
11086 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAAAACCAGCAAGGATACCAACGGTACGCCGAGCGCGAGAGCGATCTCACGCTG
AGCCACTTGTCGACGCCCACGACCGGCATGAACGCCAGCGCCGGCAGTTCCAACAGTCGCCCGGCGCCACCGCCGCCGCCAACCTCCCTCTCGAGCCTCC
ACGCCACGGAGCGGTCCTTTGAGAGCAGCGCCGGCAGCTCGAACTTGTCGTCGTCGCCGAAGCTCGCCATGGAGATTCCACGCACGACGGAAAGCGGCGG
TCGAAATTCGTTTGGCCAGTACTCGACCAGTGCGCCGTCGTCAGGCGCTACTCAAGTGGGCCCGTCCCATGGCTCCTCCATGTCGTCGATGTACAGCACG
CGCTCGACCGCCGTGCGGTCCTCTGCTCTCTCGGCTGATACGCTCGCTGAGATCAACATGCTGGCCGAGAATGGCCGCAGCCGTTCGTCCCACGCCAACA
TTTTCGGTCTCAACTCGCGGGGCGACTCGATGCCAGCGCCGCGGTCCGACATTACGCTGTTTCATTTCACGGTCCGCAAGTCGGATAGCGTGCTCGAGAA
GCTGGGCTCCAAGAAGGCGACGATCCAGCTCCAAGTCGACATTGAATCACGAATGCTGAGTTTTATCTCGCCCCATGAAAACCGCGAGAGTTACTCGTGT
GCCGCTGTGACGGCGCGCCCGCAGGCGCGACTCGGCATGCAGCTCAAGATCCAGACGGGCACGACGTCCATCAGCAAGAAGATTGTGTTCCTCAGCACCG
AAGAACGTGCTAACTTCATTGACGCGCTCGAGCAGGGCAAGGTCATGTCCAAGAAAGGCATCCCGCCGTTCCGCGGCACCGAGGTGTCGATGATGTCGGA
CGATGCGACGGTCACGTCGCTCGAGTCGTCGCGCGCCAAGCAGCGCGAGTCGATCATGGCCGACAACTTCACGCCGCTGCCCGGTGAGGCGGTGCTGGAA
CACGTCCAGCGCGTGACCAATCTGGTCGTGATGTCGCAGAGCGACCGCGCTGTTCAAGGAGTGCTCAAGATTACGACGTACCGCATCACGTTCTCTCCGT
ACGACTCGTCGTGGAAGTTTGGGTCATTTGAAGTGCCGCTGTCAGCACTCGATGTGATCACTCGCGATGGACTCATGCTGCTCATCTCGTGCAAGGACTT
GCGCACGATCCGCCTCGCAATGCACGACGCGTACACCAAGAAGAAGGGCTACGACCAACTGCCATCGACTCCTGATTTCCGGTGGCTGAATGCTCTGATC
CAACGCATGCGTCCGCCCAATATGATGGGCGCGGTGTTTGCATTTGACTACTACGCGGAGAAGAAAGCGAGAATGATGACGAAGCACGGCCAGCGCGAGG
ACGGGTGGTTGCTATATTCTCCCGTGGCGGAGTACCAGCGGCTCGGATTCCTACGCACCGACTCATTCAACCGCAAGCACGGCGTCGACCCCAACATCAT
CACCTGGCGTCTGCTCAAGAACTCCAAGTTCCGCTTCAGCCCGACGTACCCACAGCTCATGGTTGTGCCATCGATCATGACCGAAGAGCAGCTAGTTCAA
TCGGCACGGTTCCGGTCGCGTGCGCGGCTCCCCGTCGTTGTATGGCGTCATCCTGTGAACAAGTGTGTGCTCGCGCGGTCGTCGCAACCCAATTACGGCA
TGGCCGGCAACCGTTCCGAGCCGGATCGGATACTGCTCAAGGCGTACCGCGACTCGGCGCGGAAGAATGGCAGCGGCGAATCGCCGCCGCTTCATATCAT
CGACGCGCGGAAACCGATCGCGACGAAGGGCAATCGTCTCAAGGGAAAGGGCGTGGAGAACTCGCAGCATTACGACAATGCTAATGTCGAGTTTATGGGC
ATTGCCAACATCCACAAGATGCGCGAGTCGCTTGATGCACTCAAGGGTAAGTTCAGACTCCAGATTTGTTTCGGCCTGTGATATGTGCTGACTACTTCAC
TATGTGTTCATCCGCAGCTCTCGTCAGCCCCAACACTGTGGATGATGGTGACAAGCACTACCACAACCGCCTCGAGAGTACGTTGCACATACTCAATCTG
CGAAGTCGACAAGAGCTAATTGATTGATTGTGTTTCTCCCTTTGACAGATACGCGCTGGCTCAAGCACGTCATGCGCGTGCTTTCTGGTGCACGTCGTGT
CGCTGAGGTCCTGCATGAAGACGGCGCGTCTGTGCTTGTGCACTGCAGTGACGGATGGGATCGCACGCCACAGCTTGTCGGTCTTGCGCAGCTCATTCTC
GATCCGTATTACCGTACGATTCGTGGGTTTGCCGTGCTGATCGAGAAGGAATGGTGTTCGTTTGGCCACAAGTTTGCTGACCGCGTGGGCGTCGGCAAAG
ACTCGACCGATCAGCCGAACGAACGCTCGCCCGTGATGCTCCAGTTCTTGGACTGTGTGTGGCAGATGACGCGGCAGTTTCCAACGGCGTTCGAGTTTAA
TGAGAAGCTCCTGCTTCACGTCGCGGATGCGCTCACGTCGGGGCTCTACGGATCGTTTTTGTACAACACGGAGCGCGAGCGCATTTTTGAAAAGGTCTGG
GAACGCACCGAGTCGGTGTGGACACCCGTGCTCGAGAGCCCTGGGCCGTTCAAGAACCCAATGTTCCGCGCGACCAACCGCGTGATTTACCCGCGCGCGA
ACTTGAAGCGCGTCGTTTTGTGGGACGCCATGTTTTTCCGATGGGATCCAGAGAGCCATCCGGACTACATGGAGTACATGAACCCCGTGGACCCGGAAGA
TGGTGGCCGCGACGACGATCTCGCGTACGATATGGGCGACCCGCGGCGCGCCGACTTCGACGAAGTCGAGAAGGCATTGCGGCTCGAGATTGATGAGATC
CACGACTTTGACGAGATGCGCATTCGCTCGGCGTTGTCGGACTGCTCGGACATGAGCGATGACGACGAGATGGAGCTGCGCATGTCGCTCTCGGCTGACC
ACTCGCCGATGATCAACGAAGAAGAGTTTGGCAACCACGACTACGGTGACAAGTTTACGCAACAACGCGTTGAGGCCGTGGACGAATTTGACGACGAAGA
GCTCGATCGGTACCGCCGCGGCGCCGAGGAGCGCACGCGGCAGCGCGCGCAGGGCCGCAACATCCGCNNNNNNNNNNNNNNNNNNNNNNNNATCATGATG
GCGCCCGACCAGAGCCGCATCAAGTACCTCGAGCAGCTGCTGAGCGAGAGTGTGGCCCGTGAGCTCCAGCTCGAGGCCGAGCTGGACTCGGTGCAGCACC
GTGTGGCGTGGATACGCAACGGCAACAACAGCGGCAACCGCAAGAACTCGAATACCGGATCCGAAGCGAACGTCTGAAACATTTTGCGAGGCCTGGCGCG
AGGCAGGAACACTCAAACACAAACACACAGAATAGAGCACTTGGCGTAATATAGCAATCGTTATCTTGATGGTGATCAATCACTTCTTCAATTCTCAAAA
CAACCCAGTCCACAACTGCAGGTCTCGAGTGACTCGTCCTCATGGGGGACGACGACCACGCGATGCAATCACTCATGGGCTTCTCGTCGTTCGGACGACC
GCGTAAGCGACTACGTCGTGGTGGCGGTGGCAGCAGTGGCAGTGCGCCGCTGCACCACGTCGTGCCTGGCACGGCGGTCGAGCCGAGTGGTGACGAGTTA
CCAGCGTCTTGTCTCCGCATTTCCCCACAAGGCGTCGCGTCGCTGCTGCAGCCGTCACATGGGCAGAAGCTCCTCAGCAGACGGTCATCGGCGACGGAGA
GCGGCGCGTATGCTGACGACGACGGAGCCGCGGTCAAGTGGTCTCTGCCTCCAGCATCCATGGAGCTCCTCGCGCGCTTGGATGCCACTAAAGCGAGGTA
ATGTCATTATGCCTGGGCTCACTGTGGTCGTATATTTCTGACGCATGGGTACATTCCAGATTCGAGCATTTGGAGTCGGCGGCATTTGCCCACGCGCGGC
GCCGTTCAAATCCGTTCGAACCGCTGGGCCGTCACCGCTTCATCAATCGCTCGGCCATGAAGATGGCCAACTTAGATTTCCTGTTTCAGTGGACGCAGCA
CTCGCGCGAGGATGAACCGTTTGTGTTTGCCGATGTCTGTGGCGGCCCGGGTGGCTTCTCCGAGTACTTGCTGTGGAGACTCACAGGCGCGTCGGACACA
CAAGCGTGCAATGCGACGGCCCAGCAGCAACGCACTGCAGTTGGCTTTGGTATCACACTCAAGGGAGCGCCGTGGTGTGACTGGAAAGTCACCAACGACG
ACAAGGACAGTGCGGTGTTCCACATCTGCGACGGAGCAGACGGCACGGGCGACTTGTACAGGCTTGACAACATCCACAGCTTCCGCGACACACTACGGGA
AAAGTGCCCAGCGGGCGCGCACCTTGTTGTGGCTGACGGAGGCTTCCCAGACGCGCGTGACCAGAGCTGCCAGGTACACCAAGTATCAACTACGTGCGAT
GAGACATGGCGTTGATACATTTTGTGTTCGGACGCCACAGGAGGTGCTGATGACGCGGCTTGTACTCGCCGAAACGCTCACCATGTTTCATGTTCTGCGA
GTGGGTGGTCGGTTTGTGTGCAAGACGTTTGAGCTCTCGTCGCCGCTCATGCTGCAGCTCGTTTGGCTGCTACACAATTGCTTCTCTGAGATCGCGATCG
TCAAGCCCGTGGTGCGGTGCTGATATTACTGAGGCTGCTGAGTAGATAGCTCGATCGCCGACTGACTTGTGGTTCATTGGTGTCGTGCAGACGAGTCGCC
CTGCAAGTTCCGAGCGCTACATTGTCGCACAGACGCTGTTGGCCGATCTTCCACTTGATGTCATCCAGTGCGATCTCGCTCGTCTTGTCGATGCGTTTGA
GAGGAAGGACCCACGCAACGAGTCTCTCACTTGTTCATTGGAAGCATTCCCGACCATGTGTGAGCTGAGCACTTGTCTCGCGTTCGTGGCTCAAGCGAGC
GACCGGTGCGTTGGACCACTTTATCGGGAATGGGTGTCTGGCTAAGTATACTGCATTTCCTTCTGCCAGCCACGCCAAGCAGCAAATCGACGCGTGCAAG
AAGATCATTACGCTCGCAACTCCGTCGTCATCATCCGACCGCTCCAGTACTTGGGAGCCGCGCATCGACCGCGACGCGTATTACCGCACGTGGAAGCTGT
AAACATGTCAAGCAACCGGGTCAGACTGGCGTCGCCACGGCTGAAGCTGTGCGTGTGAGCCGCTCGTGCTCTCTCCGAATCTCACGAAACTGGTCGTTCG
CGCCTTCGTAGGAATACACACCAACACAACTCACACGCGCATGCTTTTTGAGGATGCGGCCAAGCTTTCGACTGATAGATCAAGGACCAAATACATGTGA
GTTGAGATGGTGGACTGACGGCAGGATCCACACTGCACATACATACCGAGTGAGTGCACGCATCATTGGGATTTCCTCTTGCGTCGCCATCGCGATGATC
TCGCCGAGTCGGTCGTCCACGACGTCGCACGCATCGAAGTCGGTTGCCAGCAAGAGCAACTTGATTTTGTGGGACTGCAGACCACGTCGCACTTCGTGAA
GACCGAGCACTAGGCGCCGCGATCGCTTGTCATGGAGCGGGTTCTGGATATGAGCGCGTTCCTGTCAAGTAAAACCCCCACAAGCCCGTGAGATAAAACC
CTACTGTAGATCTCCCCAAAACGAATACGTACCTGTAGGGACGCTAATCTTTGTACGAAAGCCACTAGCATAGTCACCAGCGCATCCGATACTTGGGGTG
CGGGGATGCTGATCTTCGTGGTGACGGGCTTCTCTGATGTCTGAGCTGCTAGAGTAAGAGGGATCTCCGATGGCTGGTGAAGGCGCACGACCAGTCTCTT
TCCACCGTAGCTCTTCAGCGTAAGCGTCTCCACTGCAGCGGCAGCCGCAGCAGGACCTATGAATCGAAGAGCCACTTGCCCTGACTCTCGTGCAATCGAT
ACTTCGTCCCAACCGTCCACGGTGCCTCTGAAGAAGCCCTCGACTTCCTCACAAACATCGTCGTATTCATCATCATCCTGGAGTTCGTTCGGATCCAACA
CGCCATTCACATACACGGTCGCTTCCTGGCGCTGTGGAGTCTCGACCCAAGTGCACGTCAGCGTGCGACCGCCATACTTCGAGTCGTGGAGGGACTCGAA
CGCAGCCCGCGCGGTCGCCTCATCGACAAACTCCACGACCACGTCTCCTGGCTGCCTGTGTGCGTCCGCGTCGCGTTCCCGGACGATCGTGAGCTGGATA
ATCTCCCCGTGGCGACTGAGCACGTCGGTCACATCGCTTACCACGTCCTCATACTCGTCATCGCATGCGACTTCGTCCGCCTCCACCATGTTCCTCACCA
GAACCCCACGTGGCGCCAGGTCTTTACTTTGCCCCGCCTGCGCGCGTATGACAGCGTTCTTGATCTTGCTGCGGCGCTTTCGTTTCGTCTTCGGTCGGAA
TCCAGTACCGTCGTCGTCCGCTGCAGCGGGAAGCTCCACTTGTTGCCGTGGTTTCTCTTCACGCGCGTCGTGCTCTTGCTGGTCATGACACTCGAGCGTC
ACTGCCAGCTCTCTGCCTCCGTAGCGATGCCCGTGCTTGGCCTCCACACANNNNNNNNNNACGACGACGTCGCCCGTCACGCGATCCACGGCCAGTGCCG
CGATCACTCCAAATCGCTCGAAATCGGCGTGAAGATCCGCGACGATGTCGGCATACTCGTCTTCGTCTTCAAGCTCTTGCGGCGACAAGAGGTTGCGCAC
GCACACTCGTCGGGCTTGCACGAGGCGTGCCGCTGGGGTCGGCCCTGGTGCTGACGAAGAAGAGGTCTTCTTGCGCGGCCTCTGTCGCCGCCGTTTCGGC
GCCAAATCCAGTGGTTCTTGCGGCGCCAGTGCCTCTATCGACTGCTGAATGTAGTCCGCGATCGCGTTGGGGCCGTGCTGCGGNNNNNNNNNNCAAGCGG
CGCGCCATCACGGCCGCCGCCCCGAGCCATCTCTAACTTCTTCAACGATGGTTAACTTTGCCGGGTCATCATAGTACTGTGGGGGAATGTGCCTCGTGGC
CCGGCTATGCACGGAGCTCCCTGTCAGCGAAGAGCTCCGTCATAGTGACACTCCGTCTGAGTCTCCGTTGGCAACTTGCCTGCGGTGGCGTGACTCACGC
TGTGCTGAGACCGAGGGCGGCGGGAAGAGACAAGGAGAAAGGCAGTCTTGCCTGCACACCCCAACGCCGACCGCAACGCTTGATGCCGGCGTCTGAGCTT
GTGGGAATCCCGCCGAAGGTTCGCCGATCAGTGGAGTCGTAAGAGCTCATTCACCAATCTTCTCGCTCCCCCACCAGCCAGTCCTCTCTCCTCTTCTTCT
CCACCTCTCCATTCAAGGATGAAGTTCCTGCTCGCGACGCTAGTCACGCTCTCCTTTGCGCTGGGCCTGAGCGCCGCGGCGCTGCCCGCGACATGCACGA
CGCAGATCCCGCGCGACTCATGCGCGTTCTACGACGACTGCCTCGAGGCGACGTACCCTTGCGGCGGCAGCGGCTACGCGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCAAGTTCTGCCGCGCGTTCAGCGGCAACGCCACGCGCTTCTCCGCCAAGGGCCAGAAGTGGATCTCGGATGTCATGCTCTGTCTGC
AGACCGAACTCGTGCCGCTCATCTCCAAGGCGCCGGCGGCCAAGCCCACGTGCCCGGCGATCAAGACGTTCGCGTTCAACTCGCACCCCAAGTGCTACGT
GAGCGCCGGCGTCTGCGCGCTCCCGCCGACCGACTTCATCGCCTTGCTCCAGGTCATCGGTCTCAAGCAGCTGCTCGCCGACTTCGAGGCGATCAAGCAG
TCGGTCACGGTCTCGGCCGAGTGCCTCGTCAAGTGGACGCAGGCGCTGTTCCACGTGGGCCACCTTCGCGGTTAAACGAGAGGCCCCCACGGAGCGTCCG
AACTCAGCAGCACTATTGATGGTTTTAACCCATATATTAACAACATGCGCTTCCATTTTTTCTTACGATTCGTGCCCCCCGCATTGCTGGTTTGCCGACG
TTATTACATCTGATCGCTGTCCAGTCGACTGGCTAGTTATCTGTGACTTTGGCGCTGTCCGTGTCATGCTCCGGACATGCTAGTGCGGTAGAATTGTCCT
CGAGAGGAGTTCCACTGCCCGCATTGAGTAATCAGGCCCTATCCCAGCGAAAGTAGAGCGCCTCCCACAGCACGATCTGCGCCTCATCCGTTCGCAGGAA
CAGCACTTGAGTTGTGGAACGATACTCATCATTTGTGAAGGGGCCTGCGTTTTCCAACACGGGCGTCCACGCTGACTCGGTGCGCTCCCACACCTTCTCA
AGGTTCCGCTCGCACTCGTTGTTGTAGAGAAACGTCCCGTACAAGCCAGAGAGCAGCGCGTCCCACACGTAAAGCAGCAGCTTTTCGTTGAACTCGAACG
CCGTCGGAAACTGACGCATTATCTGCCACACACAGTCCAGAAACTNNNNNNNNNNCAGCATCACGGGCGACCGCTCGTTCGGCTCGTCGCTCGCGCATTT
GCCGACTCCAATGCGGTCCGTAAAATTGTGGCTGAAGGAGCACCACTCTTTTTCGATCAAGCAGCAAAGCCACGGATCGTCCGGTAGTACGGATCCAGCA
TGAACTGCGCGAGACTGACGAGCTGTGGCGTGCGGTTCCATCCGTCGCTGCAGTGCACGAGCACGGAGGCGCCGTCGTCGTGGAGAATCTGGGCCACTCG
ACGTGCACCGTTGAGGATGTCAATGAGGTGCGTGAGCCACTTGGTGCCTACGAGCAAAGAAAGTGGATGAGCGAGGTGTTGACGGCTGCTTCCATTGGAT
TCGCCCTTGCTCTACTCACTCTCCAGACGCCTGTGGAAGTTCTTGCGATCGCTCAGAACAAGACCTACAGAGAAAAGCAGTGTCACTCAGTCAATATAGC
AATGGATGCAAAGAAGCAGCTCTTGATCCAATACTTTTCAACGCCCGAAGGACTCGCGCATCTTGTGGAGGTTGGCGACCCCTACGAATTCGATAACGGC
ATTGTCATAATGTTGAGGCTTCTCAACGCCCTTGCCCATGAGCCGGTTGCCTGAGGTCGAGAGGAGATCTCGCGCGTCGATGATACGCAGAGGAGGAGAC
TCGCTGGTGTTGATGCTGTTGTTTTTGTTTGCCGCATTGCGATACGCCGTGAGCAGGATCCGATCGGCGTCGCACTGGTTGCCCATGAGTCCGTAGTGGG
GCTGCGAGGGCCGCGCGAGCACACATTTGTGAATGGGATGACGCCACACGGCAATGGGCAGACGCGCGCGTGATCCGAACCGCGCCGACTGGACGAGTTG
CTGTTCGGTCATGATGGACGGCGCGACCATAAGCTGCGGGTACGTCGGAGTGAATCGAAATTTGGAATTCTTGAGCAGACGCCACGTGATGCCGTTGGGA
TCTGTCGAATGCTTTGAGGCAGCTCCGCGTAAGAAGCCGAGTCGTTGGTACTCGGCGATGGGTGACCAAACGTACCAGCCATTGTCGTGACTCGCAGGGT
TGGCGGATCTCTCCTGGTAGTGGGCAAAGACAAACACTCTGCTCACGTCAGCGGGCGGCGCGACGTTCGCCATCCAGAAACCGAGCCAGTCTTCGTCGTG
GCGCAAGAGAGCCAACACACTGTTAGAATCCCTACTCGCCATGGCGAACGCGTCGTGCATGGCGAGTCGCACAACGCGAACGTCCTTGCAGTGGAGTTGC
ACGTTGGTGCCGTCGCGTTCAACAGTATTCACGGCCGTACGTGGGACGTCAAACGACCACGCTGCGTCGGCCTCGCCGTCGGGCGAAAACACCAAGCGGT
AGTTGGTGGTCGTGAGCGTATCAGAGAATGCGCGGTCTCCCTCCGTGGTATGAACCAGTCGCTCGGCGCGATGTACAGAAAAGAATGCGACCTCGCCGGC
CATGGCGTCGACCCGCGGATCCGTCTCCATGATGTCGACCAGCCCATTGTCGCACATCAGCGTGGCCTCGGTCTCGCGCGATGGGGACTTGTCGTTCGAC
GTTCGAAGACGCCCAAGCGCTCTTAGGCAGCGGTCGCATTCCTCGGTGCTGACAAATTTGAGTTGCCTCGTACTTGGGGCGGCACTCGCGTCGGCCTGGA
GCCGCAGTTGCATGCTCGAGCGTGCGAGCGGCCGCACCAACACAGACGCGATGGCGTAGCATTCCCGCTCTTGCTTGTCTGGAGACACCAACTGGATCGT
CCGGGCAGCCTCGTCCACTTGGAGCATCAGCGACGTCTTGGACGAGCCGAGCGCATCCAGCAGGCTGTCCGCCTTGCGCACAGCGAAGAGAAGCGGCGTG
GGAGGACTGGGAGTCGCCATGGCGGTAGGAAGCGAATGGAAGAATGCTGGAGCCAACGCTCGAGCCGATGTGTACCCACCATTTCCCAGTGAACCCCTCG
AAGTTTCCCTGCAACTTCAAGCAAAGAAAGAGTGGTTCTTTCTATTTTAGACGCCTATTACGATTAATTACGATATTGGTAATCAAATCGAATAGAGGCC
CTTTGTGTTGAAGTGGGAAGGGAGAAGAGCGAAAGGAAACCAACATGGCGGCGTAGTGGACCCCCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCG
CACGGGAAGAGAGCTCACGCTCTTCAGCATCTACGGGTTGCCCGGCGGACCGCGGCGCAAGACCACAGTGAAGGGAACCGCGACCTCTGCCGCTGTGCTG
CCGACGCGACCGACGGCGCCGGCCAGCCTGCGTGCTCCAGCGTGCGGTGCGTCGCTAAGGCGAGTACGTCCGCCTACAGGAATCCAGCTTGTTAGCGACG
GGTTTCGTGGTGGTGCGCACGACGATCGAGACCGTGTGGGCGATGAGCGAGACGAAGAAGGGGCTACAAGAAGTGCGATTTCCTCACATGCCACCATTTG
CCGCGAAGAGCCGTCGCCACCACGCAGTCGTTTGCCGTCACCATTACCTTTGCTGCCACCCAAACTGTCCCCTCGTCTCAAGTCCC