Description :
From Genome Similarity Track
Location :
Scaffold_733:1427- 2593
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_733-fgenesh-gene-0.1Pectin lyase

Sequence
1166 bases(100 bases per row)
CCGGCTCCAAAGTTGGTGGTGCGCTTGGCGAGTTTGCGCGCCGCCAGTGGGGTCGTCGCCTTGACGGCCGCGAAGGCCTTGATGCCCGTCACGACCTCCG
ATTCCTTGCGGCCCACGAGCGCGCCGCTCGTCACGAGCACGTTCTCGACACACTTGCGGCCCAGGTTGGCCTGGCACAGTGCTTGGTTCGCGGCGCTGGG
GACGAACACGCCGCCCTCGGACGTCTGGACGTTCGGGTTGGTCGTCTGCTCGAAGTAGTTGCCCTCGAGGAGCGCGTCGGCCTTCTCGCCCACGTCGAAC
GAGTGGCCCGAGTTGAACGACCAGAGGTTGTTCGCGGCGTGCACGAAGGCGTTGGTCTTCCCGCCCGTCATCTTTGGCCCACGACCCGAGGTGTCGTGGA
CGTAGTTGTTGAGGAAGCTCACGCGCGTCTCATCGCCGCTAAAGATGAACGTCCAGTAGTGCTTGCCGTCACACGAGGCCGAGTACTTGGTGCGGCCGTC
GAACTCCGAGTTGCTCACGGTCATACTCTTGACGCCGGAGAAGCCCGTGACGAGCATCTGCCGTCCGACGTTGACGATGCGCAGGTGGTCGAGCCAGACC
TTCTCCATGGAGACGGTCGTCGAGCCCACATTCTTGCCCTGGATGTAGATCGCGTCGCCGCCCCAGACTAGGTGCGGGTTGAGCTCGCCGATCTGGATGT
TTTGGACGATCACGTTGTCACCCTTGATCCACAGGCCCTTGCCCAGGATCGAGCCGCTCATGCCCAGTCCGCGCAGCGTCTTGTTGCTCTCGACCGTGAG
CGGGCTCTTGGCCGCGAGGTCGTACGTGACCGTGACCTTGGTGCCGTCCTGGCAGCCGCCAGTTTTGGTCATGGCCGTGTCCCCAGCGTTCAGGATCACA
TCCTGGCCCTGGAACCCGCTCTTCTTGGCGAGACACTCGCGGTTGTTGAGTGGACGGCAGCCGTCCTCTGTCTTCTTGCCCTCCGACCCGCGGTAGTCGT
ACGCCTTGCTCAGGATGATCACGCGCGGCTTCGAGTCACTCAGGTACGCCTTGAGCTCGGCGAGGTCCTTGGGGTACACTGGCGCGGCGTTCCCACCGCC
CGTCGTGCCAGCAGCGAGGCCTGGGGCGTTGCCAATCGTCACAGCGGCAGACACTGGGGTTACGAT