Description :
From Genome Similarity Track
Location :
Scaffold_3417:1427- 2545
Sequence
1118 bases(100 bases per row)
GTCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACCTCCACATGACAAGTTGGATGCTGGT
TCCTAAGTTGGATCTTCATAACCCACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTACTCGTCGACAGTGGTGTTCTGTCGTCGAGGATGGCCT
CGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCCTCAGGCAATAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAGTAC
CAACCGAGTGTTCGGTCGACTGTTGAATTCGTTGACAGCCTTGAGTCTCGACACATGCACTACTGGGTAAAAGCGATACCCACTTCGGTCAGGCAGTTCC
AGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCACCGGTAAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCATGT
ACAACCACGCCCGGCTCCCAGTCTCAAAAAGAGATCTCGGTGGGGCTCTTGCAGGATCTTCCACCTCTGCCGAAGCTTCTGGAGGGTCCGCCGAGTGTTC
GTTTCCACTTGGTTGAGGTACAGCTGCTTTTTCCAGTCGACTCAGGGCATCATTATGCTTTTTAGCCCTTCGCTTCTTTTCTACAGCCTGATAATCTTTG
GCCATAGTGAGGGTGACCTCATGTTGTCGATTGATTTCACGCCGCCACGCTAGTGCGTCAGACGGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATCG
CTCGCAACGTTGACTGCGCATCCCAACCATGAACGAGGTAGAACGGTTTCCTTTTCTTCCTTGTAGTGTCCTGAGAAGTATTAATAGCGAACACCAACTT
CTCTGCGATTTCATCCCAATCTTGCTGTAGAGGTTCTTCCGCGTACACCCGTACGGAACCCATCACCGACTTCACCGAGCGTTCCTGCTGTCCATTAGCC
TGTGGCCGATAGCTCAAAGTCGCTCGTGATCTTGACTGCATCATCTCTGCAAATGCTTGGAGCACCTCGCTCATGAAGCGTGGGTCGCGGTCGTGCCTTA
TCAGTGATGGGGCTCCGA