Description :
From Genome Similarity Track
Location :
Scaffold_7:1426254- 1429014
Sequence
2760 bases(100 bases per row)
GTACCTCTTAAGACGACCCACGTAAAACGTCGGGTGAGTCGTCATTGACTTGGGCAAGTCTATGGTGTACGCCGCGCCATGCCGGCTGAGACCGTGAAGG
GTCCAATGAAGCGGTGCTTCAGCTTGTTGCTCTCGACCTAGCTAACAGTGTTTAGCGGTAGGTTTCTAGTATCTAGGAGAACTAAATCCCCAACCTTAAA
CACGTTCATGTTTCCTCTTCCATTTCGGTCAGAGTACTCCTTCTGTTTGTATTGGGCTTGCGCCATGGTAAATGTCTCTCACTCTGCTGATTATGTTCAG
CCTGGCTTCGACAAACGAGGACAGTTGCTTCCGCAAGGCGGCTGGACTCACGTCGGAGACTTGGGAGGAAAAGGTTTTCCGAGCCTCTCCCCTTCTTAGG
ACCGAAGCCCCAGTGCTGCCTCGTAAAGTGAGCGGCACCTGAGGGTGGCGCAACCCGTTCAGATAAAAGGGCGTAAAGCCCGTCGATGCATGCACCGCAT
TGTTGAGTGCGAACTCAACCATGAGCAAATGATCAACCCAAGAGCGGGGCATTTCCGCGCAGATACTGCGGAGCATGTCCTCGAGCACGCGATTGACGCG
CTCTGTCTGGTCACCCGTCTGCGGGTGGTCCGCCGTCGACATCGACAGCCGTGTGCAGAGAAGGCGAAACAGCGTCTGCCAAAACGCAGCGGTGAACCGC
GGGTCTCGATCAGAGACAATGGTCTCGGGCAGACCGTGGTGGCGGAAGACACAGTCCATGAACAGGCGAGCGACCTCATCGCCAGTGACGGCGTCACGAA
CTGGAGCAAAGTGTACCATCTTGCTCAGACGGTACACAAAGGCAACAACACCAGTGTTGCCACGGGCATCGGCCGGAAGTTCGAAGACAAAGTCGAGACT
CATCGACTTCCAGCAGTCCGCTGGGACCGGCAGGCTCTGCAATGGTGCCGAGGCGTGACCGGCAGGCTTCACGCGCTGGCACGTCTCGCACGTCCGGACG
TAGGTGGCGACCCACTTGTGCATGTGACGCCACCAAAACGTCTGCGAGACAGACGCGTACGTCTTCTCACAGCCGAGATGGCCACTGGATGGAGCGTCGT
GCGCCTCCATCAGGATGTCGTACTTGAGATCCTCGTCGTCGGGTACGACAATACGGGGAGGATCCTCGGGCTCAACCCTATAGTGAAGCAAGCCATCAGC
CCACTCATAGCGGTGCAGTCTTGCACGCTGTCGGGGCGTGAGCCACTCGGCCTTGGCGTCCGAGCCAGCGGCCAAGAACCGCACAAGAGGACCGAGACTG
GCATCGTCTCGGTACCCCAGCCTGATGCGATCATACCGATCCGTCGTGACCCGACTAATGTGAGCAAGCTCGTAGTCGGGTCGGCGCGACAGCGCGTCGG
TAGGCACGTTCAGCTTGCCCGGCTTGTACTCTGTACTCGACATGGAGGTTGTATTCCGCGAAGAATGACAGCCAGCGCGCCATCCGCTGCGAGAGGTGCG
GCGTGTTGACGGCCGTCCGCAAGAACGCGTGGTCTGTATAGACGACAAAGGGCTTCGAGCCCAGGAGATGTACTCGGAACTTGGCAAGAGCGTACTTCTA
CTTCATTGCAAGTAGCTCCTTGTCATGAACTGGGTAGTTCCGTTCGGCTGCCTTGAGCTGCCTGGACTGGAACGAGATGACCCGTTCGCGGCCTTCATCG
TCGGCCTGCAATAGCGCACAGCCAATTGCGTAGCCAGACGCATCACAGACGACGCTGAAAGGCTTCGTCTCGTCCGGCAATGCCAGGACTGGCGCGCGCT
GTAAGCTCGCTTTGATGTCGTCAAAAGCATCTTGATGGCGACGCTCCCAGCGCCAGTCAGCATCCGTCTTCAGGAGATCCGACAATAGCTGTGCCAGCCC
GGCGTAGCAGCACAGTACTTGTGCAAATACTTGGCCAGGCCCAACCACTGTTGTAGGTCCTTCTGTGACCGAGGCGGCGACCAAGCCGTGATGGCCTTCA
CCTTCTCTGGGTCCGCGGGGATCCCGGCTCTGCTGCTGACGAAGCAGCCCAGGACCTTGATCTCCTCAACTGTGAACACGCACTTGTCGATGTTGGCATA
CAGCTTGTTTGCCCGCATGACTTCGAACACACGGCGGAGGTGCTGGAGATGCACCTCCATGACCGTCTGGCCTGCCTCGACACGGCTGTGGACCAAGATG
TCGTCAAAGAACGTCTGTGCGAACACACGCAAAGGTCAGAACAGTTGTGTGATCAAGCGATTGAACTTTGCCAGGGCGTTTGAAAGCCCCTGAGACATGA
TCAGCCACTCCCAGATCATACCGCTCGGCGTGCTCAACGCGGTGAGCGGGATGTCGCTCTCACGCATCAGGATCTGGTAGTACCCATCCACCAGGCCCAG
CGTGCTGTACAACGTGCAGCCGGCCATGTTGTTGGGCTACAAGTCCTTGCGCGGGGTCGGTGTCTGTGCAGGTACGGTCGCTCTGTTCTGCTTGTTGTAA
GCATGAACCAGACGCCACTTTCCGTTCGGTTTGCGAACACAGAAGGTAGGGGTCGAGTGCGGAGACTTCGACTCCCGCACCATGCCTGCCTTCGCCTTGG
CGGCAAAGAAGGCATCAATGACTTCACACTGCTCCCGGGGAAGAGGCCATTGCCTCGTGACACAGTACTTCGTGCCCGGTACGAGGTCGATCCCGTTCCT
GATTCCGCTGTCTGGAGGGAGATTGGACGGTGGATCCTTGGACACCACGTCCTCGAACTC