Description :
From Genome Similarity Track
Location :
Scaffold_106:14260- 15309
Sequence
1049 bases(100 bases per row)
TGAGACAACAGCAGGAACATACTGCTGTTCTCGTGGCGACGCACGCGCGTCGACCCGAAACCTTAAAGTCTTACATCTCCAAGTACAGAGGAGTCGAGGA
AGACTCCCTGTACAGATGGTTTGTCGAGATGGACGATTACATACGGGCTCGTCACATCGTTGACGGGCAAATTCAAGTCGCATTTGCTCAGTCGAACTTG
GCAGGATCTGCCAAAACTTGGCCATTAGGGCTCAAGTTGAACGGCTGCTACGTGTTTGGGTCATTGGGGCACTTCAAGACACGGCTCGGACAGAAGTTTG
GACTGCCACGGGCTGAGTTCAGGGCTCGATCAGAGCTCCTGAAACTTAAGCAGGGTAAGCGTGATGTGCACGCTTATGCCCAGCACATACGACTTCTTGG
TTGTTGTTTTACGGCCAACCCGGTCCATTAACACTCGTTTGTTACAGTGTTCCTGCACTTGCGTATGGTCCCGTCAAGTTCCACCAGTTCCACCTGGATC
TCTATATGCTTGAAGAAGCGATCTCAGCTGAGGAACAGAAAGCATTTAGCTTGAGACAGGCTCATCTAGTTCGGGGTCTTATCGTCCCTAAAAAGCCAGG
AGGTAGGAGTTACAGCATCCATGGATCTCTGAGATCTCTCACTCTCCTGGCTTGAATCGATTGCAAGGTACAATCGCTGTCAAACAACAGGCCATTGTGA
TTATAAGTGTAGCGCTCCGAGTATAGTACCTCGTACGGCAGTTTAAAGTGACCGTCAGCTGACCAAGAAGGACCCAAGGCGCGGATTTGACGATGCTGCA
ATCGCAACAGCGAGGCGGAACTTCAAAAGACGGTCGCATTAAGTAGGGGCGGAGAACCCTTGCTGATACAGCAACGTCAAGAGATTGGGAGTCTCTTGGC
GCAAGTTTCTACCAACGCGCAGTCACTGTGTGTTACGGCTACTGGTGATGAGGAATACCTCATCACCTTGAAGATTGAAGTGACACAGGATTTTTCAGTT
TCGAGCCCTAGTAGACTGTGAGGTGTCGAGCAATTTTATTTAACGCCAG