Description :
From Genome Similarity Track
Location :
Scaffold_2166:1426- 2626
Transcript NameFunction/comments
Phypl_g14765hypothetical protein

Sequence
1200 bases(100 bases per row)
AGTGTCGGTCGACAACGGAGTTCGGTCGTCGAGAATAGCCTTGACCTCAAANACATGCACCATCGGATAAAACCTATATCCACCCCGGTCGGGCAATTCC
AACTCGTACGCAAActcctcgaccttcttcttcacacGGAATGGCCCGTGCCATCGGTGGACCAGTTTCTTGGTCAATCCCGACTTCACGCGTTCCATGT
ACAACCAGACTCTGTCCTCTAGTTGGAAAAGAGACCTCGGTCTCGCGTCAGGAGCATCGTCAGCTGTCCCTGTCTCCAATGGAATCTCGTCCGACGCCTC
GTTCTCATCACCAGTAGTCGGTACCACCGCTCGTTCACGTCtcccaagcagctcgttATGTTCCTTCGCCTTATGAGCTTTCTCGGTGGCCTGGTATTCC
ATAGCCATTCTCCACGAAATCTCCTGCTGTCGGTTCACCTCTCGGCGCCACGCCAGTACACCGGTCTGGCCCCCAGAGCCTCGTTGGAACGACGAAGACA
TTTCCCGGAGCGTGGACTGTGCATCCCAACCACGAACGAGGTAAAACGGAGTGTCCTTCCTCATTTCATCTTGTGAGTTGTTGATAGCGAAAAACAGTNC
TTGTGAGTTGTTGATAGCGAAAATCAGTCGCTCGGCAATCTCGTCCCAGTCTTGCTGCAAGGGGTCTTCGGCATAGACGCGTACAGACTGCATGACTGTC
GTCACCGACCGTCCCTGCTGACCGTTCGCTTGTGGCCGATAGCTCAACGTTGCTCTCGACCGAGACTGCATCATCTCGGCAAAAGCTTGGAAAACCTCGC
TCATGAACCGTGGGTCACGGTCGTGGCGAATCAACGTTGGCGCTCCGAACCGTCGGTATACACACTCTTCGAAAGCGTGCGCCACCTTTAGTGCAGTCGT
GTCGGACATTGTTTTGCCCATCACGAAACCGGTGAACGCGCACTGGAACAGCAGTAATGCCGTGTTCTCACTGCGAGACTTCGGTAACGGTATGACGAAA
TTAATAGAGACAATCTGGAACGGTCTCTCGGCCAGGATGTTCCCTGGTGAGTGGCCTCGGAACTGCGGTCGGCTCTTGATCGAAACGCAGTCTGGGCAAG
ACTTCACATGTCGCTCCACGTCTGCATAGACACCAACCTAATAGTAGTCAGCCCTGGTCCTGTGATAGGTCCGACCGATACCTTGGTGGCCGCCTTCCAG