Description :
From Genome Similarity Track
Location :
Scaffold_9:142579- 144819
Transcript NameFunction/comments
Physo_306608Hypothetical protein
Physo_290078Hypothetical protein
Physo_339874vacuolar protein sorting-associated protein, putative

Sequence
2240 bases(100 bases per row)
CGTAGACGTAAAGCATTTGTAGAGGATCCCCTCTTGTTCCTCAGCAGGAATTTGCAATTTTCGACTCTCGAGGCTCTCAGTCACGTTGAGTGCCTCTCGA
CTTGTATGAGATTGCCTTTCGAGTGCTCGGCGCTTGCTGGGTCGCCCTCCATCGACCTCTAATTTAATGTCGACAACCGTGGCGTCTCCTGTGCTCGGTG
ACTGAGCCGGCCTCAAGGAGGAGCTACTCGACGGTTCACTTTGCTCCATAGCCGAGGTAGACAACCCACGTTTGTGAGTCAGTGAGGGTGAACTAAGGTT
ATCCCTCCTGTGGTCGGCTGATCCCAATGCAGACGGCTCGGTTGAGTCACGTAGAGATGACGCGAAGCCGAAGGTGGAGGCATTGTTGAGCGAATTTCTG
CCGTGGGATTCGTCTCTGTTGCCGGCACCGATTCGTTGTTCGCTCGGCTTGTTGACATTTCCTGGAACTCGACGCCACTCGAAGCATTCATACCAGCCTT
GACATTATCGAGAAGCGGTCCAATCTGCATGCCGACCGAGGCCATTGCCGCAAGGGACGCTTGCACATCTGGCGCCAACGTGTTCAGCGGTGTCCGAGAC
TTGTGCACGCTTTTGGCTAGGCGCACCACCTCCTCGAGACGTATCAAGGAGACAAGTGCTTCCTCCAACTTAGTCCTCGTGTGCTGCACCTCATCCCTAA
TAGCAGGATGCATTTGCTTCAAGCCGATAGACGCCGTATGAGCGCCACCTCGAAGCGACATGTGCCCACTGGCTCACAACGAGCGACACCGCTGACTTCA
TCGTCTGAATCCGAGCTGCCTGCTGCCTGCAGTTCTTTGCTAGTGCCTCAACATCTGGAGCTCTACAGACAACGACTTATAAAGCCGGCAGACACAAAAA
GCCGGCAGACGAAGTCAAGCAAAGCTTAACATGAGCAAACCAGCCAATCAGATTCAATCAAATGACTTCATCTTTGTATACCATCTGGTTTTGTGTACTT
TATATGCTTTCTTGTGTACTTTATGCAACACGCCGTGTGTTTTATGACAGTTTTACAGATTTGACGGGAGGGAATTTATCGTTGTTTTTATATATGAGGA
TGGCATTAAGCATGCCGGCTTTGTAAGTCGTTGTCTGTACTGCAAGGCAGCAGGATAATTCTGGCATCGCAGTGAGCTCGCGCCGTTACACCAGCAACCG
CCGCAGCCCGCGTGCGTCAGTCCTGAAACAGCAGAGCAGCCAACAGACCAGACGCACCGAGCAGCATGAGCGGTGGCCACCAGGAGAAGCACTACTTCAC
GGAGGAGTACCCGGACCATGACTACCAGTGCACGACCGAGTCGGCGCACCCGCAGACGCCGCTGTGGCCAGCCTACCTGCCGGCGAACCAAGACCGTGTC
GTCGTCTTCGAGCGCAGCAAGAACGCGCAGCTCGTGGTGTACTCGGCCAACTTCCGCGACAAGAAGCGGCTCGAGCTGGACCCCAAGTGGCCGCTGGACA
TCAACTGGCAGAGCTTCGGCTGGACGGCTCACCCCACGAGCAACCCCACTGGCATGATTGAGCGCCGGTTGGCATGGGGCTACTCGCACAAGGCCGTGGA
GCCCGAGGGCCCCGTCGCAGTTGAGGCGGTCGGAACCAGCTACAGCGTGACGCTCAACGCGCTGCCCAGCCGCCCCGCCTTGCTCTACATCGATGCCAAA
GGCCGAGTCATCCTGCAGACCACGATCAACGGCGTGCAGTCGCGACTCTGGAAGATCTACGTAAAGACCAACAACACGCTCGCCTTCATCCCCAAGGTGC
TGTACGTTGACCTTTACGGCACGAACGTCGACGACGACCACGCCACCTACGAGCGCATCACTATCTCGTCCTAACTTAGCGGCCAAACGGATCCACGGTT
CGCCCGAATAGAAATACACATTCCTTACTGCTCGTTACCTCGTGCTAAGTTCCATCTCGCTTCGGCCCTCTCTCCAGCTCCGCCTACCGTACGACGTGTC
TAGAGTTTCTTTCCATCGTAGTTCCAGTTGCCATTCGCGCCACCGTGTCCGTGCAGAGGAGATAAATTGTACGCCGCTGCTACCTCCTCGAGGAAGCTGG
TGGAGTTGTGAATGCACGATCCACCGAGCAGGATGCGCTGACCTGAGTTCGACGCAGCCGCCTTTTGATTGAGCTCGGCTACCTTCATGGCCTCTTCGAA
GGTCACGCCGCCACATACGTAGACAATCACATCGCGCACG