Description :
From Genome Similarity Track
Location :
Scaffold_80:142534- 145564
Transcript NameFunction/comments
g8383.t1XP_008899117.1 hypothetical protein PPTG_06825 [Phytophthora parasitica INRA-310

Sequence
3030 bases(100 bases per row)
TCCGTGACGGCGAGCGCACGCAGGCGCGGATGGCGGTTGTAGGTGCGCATGACTGCAGTCGGCAGGAAGCGCAGCAGTTGGTCCATGTCTCCGCTTATGG
CGGTGGCGTGGCAGCACTTCATGGACACACACGGATCGGCGACGCCGAAGCGCTCAATGCCACGCAGCGGGAAGCGGCGCTTCCTATCATCGGTGACGAC
GCTCTCGTTCGAGATGCAGCTCATAGCGTCAAGTCTTCTCGAGGTGCGTGGCAGATTCGAGTGTGGACCGAGCGATCAACTGACACCTCGACAGAGCAAG
GGGGGGGCAATGCAGCAACGTGAACCTTCCCGTGGTGGTGGGGCCAATAGTATTATGGTACCGGCAAGATACGTGGAGGTCCATGCGCTCAACGTCTTGC
CGTGACCCGAGCGCAGAGCGGACACCATAGACTCCCCACCGAGAACATCTCATTAGAGATGTAATGTCAGTGCTGCAAACGAGGCGAAGTGGTGAGATCA
ACAGTCATGATATGACAACGATGGCTCGAGCTGAGGATGTTTTGACTTGGCTTTTGGACGATGGTCTGTGCACGCGCGTACGTGGACATTGATCAGCTTG
CACAGTACCGGTAGTTTCATGTGTACAACAATGTTGTTTGTTTTATCGTTGATCATTATCGTTGATCATACTGCTGGAAGCCGTTTTGATACGGAGAAGT
GGCTCGATATCATCGTGCTTTCCGTGCAACATCCAGTTCGTTTGAGCTTATCAGTCCACGCGAGCTCGTTTAGTGCGTAACAAGGCAACTGCATCTTCAT
CACCAGAATTTGTCAGTCGCGCTATCGCATCGGCGATACTGCAAGAGTCACACCGGGGGCGTAGCAGCTCGAACACCTCCAGGCAACTGTCTCTTGCTGC
CGACCCGAGTGCGTACGAGGTGCTAGCCAAACCGCATTTATCAGTCAGCGCTCGAACTACCTATGGACCTTTGATTGCGCGTATGTCGATTTGATCCAAC
AGCAAGCAAGTGAGAGGAGCAATCCCCATCGTAACAGCATAGTAAAGTATGTTCGTGAGGGCTGAAGGCTTGCACTTCTCCAACAGCTTCGTAGCTGTTT
CTGGTTTGCCCATCGAAGCAATCTCCGTCACAGCCCGATATCGTACACAGACGCCTGGCTTGCAGCTAATTTGCGCCTTGTCACGTCTCGCATCAGCGCA
TTGCACCGCCAAGAGTTCAAGCTCTTGATATCGTCACGTCCAGCAGTCGATATGAATGCACGACGCAACAGTCCAAGGCCGAAAATGTTGGCACTCTGGA
ATGAGGCGATGAAGTTCATTGCACACTGCAGCGTCGATGGTGGTCGGCAGCAGCGACTCGTTGATGAGTTGGTACACGTGAGGCAGAGCCTTGATCTCAG
GCGGAAGCACCAACTTGGCGCGAAGAAGAACGCCATTTTGAGGAGAGTGTACTTATTTTTTCTTGCCAAATTTCACTTATTATGTGGAATATTGTATACA
AAGATCGTCCTGCGTACCGCTGGTCCTTGCCTCCCTGTACTGTGTCTAGCGCTGGCACTTCTCGACTGTGATAGCCTGGGGCGGTGGCGGTACTTGACGA
TCAACTCGTACTCCTCCGCCTCCTCGCCCTGGTCCTTGGTCGCGATCGCCGTGGCAGCGTTGACGAATGAGTCGAAAGCGAAGCGCTGGACTCAGGCCTC
AGCCACGCGACCATCCGTGAGGGTGCTATTATATGAACATATATAAAATATACTGGCTGCTCTCATCACCTGGTACGTCGAAGTAGTATACAGAGTTCCC
CGGCAAAGGGAAAAAAGGTGGGATCAATAAAGACTGCGAGGTTGCAAGATTAGCAGAGAATTTCATTAAGAGCCAAATGCACTGAATTCTTCCGAATTAT
ACGACTATTAATAATAGTCAACATTATAGCAGAGCATGCATGTTTCCCGCAAGACCGCGAAATATAGTTTGGTTTTAATGAGGCCCTCTATTTGTGTTTA
ACTGGAAACTATAGAGCCCTGAAAGTCGCTGGGGGCGTCGAAGCCCAATATCTCTGTGGGACTTTAACCCAATGTTGATGTATCGAGGCCGAGGTGAACG
GCAGATGAACTTTACGGAAGCAGGAGGGTCACCAAGATCTCCCGCCACGGTGGATCACGATAATCGTGCAACACGAAGGCTCCACCAAGTCCTCCGCGTT
TTGGTGGGCAGACTTAAACACTTGAGGATCACCACGTCCTCAGTGGTTTGGTGCTGGATCAGAATCGCTACGGGGCACCAGGTCCGTCGCGATGTGGTGG
GAAATCTTGATCACAGGAGGGGTCACCATGCCCCCCGTGCCTTGGTACTTGAGCAGCTTGGTAGTAATCCTTGCTTTCCTCTTCCAATTGCCCTTCGAAG
TCAACACACTTGTTCGAAGCAGGTTGAACTGGCTGGGGCACGTGGGAGGATCACAGATCCGCTGGTACAGCTTCCGGGGGTTAGTACGCGTACCTTGAAA
AGTGTCTAGGGCGGTTGCTGGCTTTGCAGCTAAACACTTAGACCGCGAAATATAACTTAGATCAGTAAATGTTCACGGTAGCTAGAGCAAAGCTTCTGCA
GACCCGTACTATTTGTGCGTGATAAATTGCTGCACGCAGTTCTCCCTTTGCCGGGGAACTTTGTATTACAGCAGTAAACGGTAAGTGCACGACACGAGGG
TATTTAATCAAAATACAAAGCTTCCCCGTGTGAAACGCGGCATTATCCATGCAGTGAGTTAACCCTTTCACTACCAGAATTAGAGGTCCGCAGTGGACCG
CTAATGGTGAAACGCATACGTTTTGGTGTTGTAATTTGCCAACATTTTAGGGATGCTCTGTTGCGGGTCCGCAGCGGTCCTTGAAGTCGCCTGTTTCCTG
ACCGTGCCGAACTATCTTGGATTTTTGACCAATAGGTATTAATGTTATAGCCTCTATTAAGACGCATATTTTCGGCTGGTAGTAAAAGGGTTAAAAGGTA
TAAACACTGATCGGCTATTAATACGTGTTC