Description :
From Genome Similarity Track
Location :
Scaffold_47:142470- 144555
Transcript NameFunction/comments
Physo_136639predicted protein

Sequence
2085 bases(100 bases per row)
GTCGTTCGATAGAACTCGAAATGCAAGGCGGTTGCAGCTCCGCGCTATTTCGTGTATTCACACACGAGAAATGGCAATGTGAAAATTGCAGCGTAGGCGC
CACTTCGCCATAAAAGCGACTAGAGGCGAAGCTTTGGTCTGGGAGGACAGTGTAGACTTCCTTTGTGTGCCTATATTGATAAACGTGGGGTAGGCAAGAA
TAATGTAACATGAAAGTTGGTGGCAAGTTTTCAAACCCTGGTGTAGCGCCTTAAAAATAATGGCGAAGTTGCCGCGCAAAAGACACGAAAGAACTTTAAG
GCGCGCTCGGCCGGGGGTTTTGCCCCGGCCGAGCGCGTTGAGGTCATGCATTCCAGCTAAACAAATTTACACAAGAAGGATTCATGGGGTTTAGTCAATT
TACAGACGCAGGAAAGAGTGCAATCCGTTGGTTGTTATTTCAATGATTTTTAGTAAATGTTAGCTTATAACGAAAAAATACAGCTATCCTAGTAATGATT
TTCCGAATAAATTTCATAAATTCAAGAACTGCTCACTACAGTGTGTGGTACACGCTACGGATACGGTCAACATTCTGGGAACAACCAGCCACGAAACGTA
CAAACTCCTTGATGCTACGGTAGCCACAATCTGTGGACTATGGACTCAGGCGACATTCGCCAATTAAAGTTGGGGGGGGGGCCGCTGAAATAAAATTGGT
TAGGCTGTTCAGCCAGCCAGCCTCCCAGTATGAAAAAGAGCTCTAGCCCCCTAATTGAACATGGTGGCTCCTTGCATTGTCGCCTCTAGGCAACAGTTTT
GCGCCTGCGTTGCAGCGACAAACTTTGAACTGCGCGGCCTTCTTACGCGTTCCTCACTAGACGAGGTTCCAACTTGAAAACGCACGCCGGGTGTCGCGGA
GTGTCAAGCTTTGAGTTCATTTAAACTTATGAAAAAATTTTCACATCACAAGCGTGCTCGGTTGGCCGAGACTGATGAGTACGTGAAGCTCCTCTGACTT
AATCCGGCACGTGTAGTCCGCTGGGGTATGTTCACTTGTTGGCAGGTAGCTTAGAAGAGGCTGACCTCCTTCTTCTTGGCCTGCTGCTTCCACTTGGGGA
GCTTCGCGAACTCGTCCTTGCTCATTTCCATTATCGTCAGGAACTCGGCGTCCGTAAGGTAACTCTGTGGGAAACAAATCCGTTCATCAGTTCAAGCTGC
TACGAGATTGAACAACCGCAGTAGTCTACGCTTACCTCCTTCGAAGTAATGTCGATGCCCTCAACGCCGGCCTTCAACTGCTCGTAGGTGAAAGTCTCGC
CCGAACGACCGGTAGCCTTCGCAGAAACCGGAGCGGGGGCAGGGACTGCCTGCGGGGACGCCGGAGCAGCCTTCGGGGACACCGGAGCGGCCTTGGGGGA
CACCGGTGCAGCCTTGGGCGATGCCGGGGTGGCCTTAGGAGATGCCGGAGTAGCCTGAGGAGATGCCGGGGCAGCCTTCGGGGACACAGGTGCAGCCTTG
GGAGAAACAGGTGCAGCAGGGGGCTCAGTTGGAAGGACAGGGATAACCCTTGCCGCCACCGGAGCTGGCTCAGGGGTCTCCTTCTCGCAGATGTCCTCGT
TGGTAATCGTGCCGGGGAGGTCCTTGGGGACGTTCTTCTCCTTCTCCTCCTTCAGCTTCTGGAGGCGAGCTTTGTAGGGGTCCAAGAACTCGTTCTTCGT
GAAGAACTCGCTGTCCCAAGCAAGGAAGTTGCTCGTGAACATGAGCGGCTCTTCGTTGCAGTGCACCGCCACGATGGGTGTGCCCTCGCCGCGGCCGTCG
CTCTTGGCAACAGCAAGGTACTTCTCAGCGAGAGCCATGGCCTCACGCCTCTCCGGCTCGTTAGCACCGGCACCGATCCATACGTACAGCGTCGTGTAAG
TATCCAGAATGAAGACGTCATCCGTGTTGAGGTCGTCCTGGGCAAAGTTCACGATCTCGTGCGCGTCGAAGTATCCGTGCGCGTTCGAGCACTGGAACAG
GCGAGGCTCGTGAGGGGCCTCGAACGACGACTTTGCCTTGGCGTACTCACCCTTGCCACCGAGGAACTCCCAGAACTCGTCCGAC