Description :
From Genome Similarity Track
Location :
Scaffold_15:142459- 144750
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_05174cell division cycle 5-related protein, putative
Sappa_CBS223.65SPRG_05175unnamed protein product

Sequence
2291 bases(100 bases per row)
ACAGAAGGCGCAGATCCTCCACGGCGGGTACGAAGCCAAGTGCGCGTCGCTCGGGGCGGCGCTCCAGACGACGCAAGCCGCGTGGCTCCAGTCGGAGCGG
GATCGCCACTGCTTTGCCAACCTCGAGGCACTCGAAGCCAGCGCGCTGCCGCTGCGTCTCGTCAAGGTCGCGCGCGAAGTCGACGCGCTCCAGCTCAAGG
AAGTCGAACTCCAAAGCAGTTTGCAGCGCTCGTGGAAGAAAAGGACGCGCTCCTGTCGGCGTAAGCAGATACTTTATATACACTCGATTCTCGGATTCTG
CTACATGGTCGCACACGAGCAGCCCGGCACGGCGGACGACCCCGGCGGCTTTTCCCAGTCGGCGAGCGCCTTATTCGACGGCGCGACCGTGACGGTACCC
CGGAGCGTCCCCGCGCCAACGCCGTTCTTGACCACTTGGCGCTCAAAGGCAACGCCGGCGTCTTGCGCGTAGAGGTCGGCAAGGCAGAGGACGACTTCGC
CTAGTCGTCGCAGCCTCTCAGTCATGTTTTAGCGGGATCTTCTTACCCAGGGCGTCGTCCGTGGACGTGGCGTCGTAGTCCATGAGGACGAGCACGAGAT
GCACCTTCTCGAGCTCGTGGAGCCGCGCCTTGATCTTGAGCGTCGGCATGACGTCGTCGCTCCACCTACGTACGGTGCATGAGCACACCGGATAAGATCA
TAGTCTACGAAGGGTTGACGGTGGCCTTGACGATGCCGGACTGCGGATGGTGCTTCCCCGCCTCGTCATCGACGAGGAGGCCCGGGATCGTGCAGATGAA
TTTGATCTATTGCAACACGGTGCTGTGCATGTCCGACGCAGGGTGGCGTACGTAAGGGTCGCTCGTGCCCGTCAAGTCCATCGCGAGGAGGTTCTCGGCC
GAGACGCCTGCAAAGGTCACCTCCAAACTCTAGCACGCCCTTTGCGTGACCGATCCTCGAGCACGGTATTCGACCAACCTGGTGCGGCCGCGGCAGTGGC
CCTTGCGGACTGTAGCGCCCAACTTCGAACGCGCCAAAGACAGGCTTGTGGTCGCTACGCCAATAGCATTGAGTGCCGAGGACGACATGACGACGGCTTT
GTACCTCGTCGTGATGGACTCGACGCAGTCGTACTGCGTGAGCGTCAGGTGCTTGGCGAACCCGGGCAGCGACGTCCACAGAATCCGATCGCAGTACGAT
GGGACGCGCTGGCGCTACGTCACATGGCGTCAGTTGGCGCACGCCACGTCGCGCGACGCACTGTAAACTCGTGCACTTGGCCGCGCACGCGCTTGAACGT
GGGCGGGAAGAGACACGGCGCGGTGTGCCAGCCCACGAGCGCCTTTCCATCTGCGAGCTGGTGCGCGAGCTGGTCGTTCGCGTTGAGCTGCGCATAGTCC
TACGCTACTACGTTCACACGACGAATTCTCGGGCATGCCACGGACCTTGGCGAGCACGAGCGCGTGGACGTCGTCCCAGTGCGTGTCTTTGGACGCTGGC
GTTCCCGAGTACTCGAGGTTGATGCGGTAGTTCATGTCGCCAAACCAGAACGCATGGTCGAACTGGTGGTCCAAGCTCAGCGACTTGTGCCCGACGCGCG
CGCCGTTGAGGATCTCGGTGCACTACCAACGGAGCCATGAGGCGCTGCCACGTCATCGAGGACGCACGTCGCTGTTGCGGCGGTCGAGGAACTTTTGCGC
TTCGTGGGCGGCGAGGTGGCAGTTGACGAAGCAGAGCGAGACGCCGTCGACGACGAGCTTGACCACCGCGCCGCCCTAACCTTGGATTGTGGCGACGTCG
AGATGTGTACTGTGTCGAGTACCTTGTTGCCGATGACGTTGCCGACGCCCGTCGCTTCGGTCGTCTTCTCGACGTCCGTGCACTGCAGTATGAGGTATGA
GAGACGCGATGACGAAGAAGAGCGAACAACCTTGTTGCGCGTGTGGACAAACACGATGAGCCGAATTTCCATGAGCTCGATCGAGCCCGCGACGGTATAC
GAGGCGCCGACGTGGTCTTCAAGCTGCTGGAAGAACGCGTAGTGGGGCAAAAGGCTGCGCTTGGACGACGCCGACTTGACGAGCACCGGTGGTTCGGTTC
GCTCGACCGGTACCTCTGCCTGCTCCGCCGGGGCGGCGTCGGCGGCGGCGGTGGCGTCGTCGTCGTCTTCGTCGTCGTCCTCGATGCTCTCGGTCTTCTC
AAGCACCTCGTGGCTGCTCGCGTGCTTCTTGAACGAGCTCTCTTGGAGCCCGATCGCTATCACGTCAAAGTCGCCGCCATCTACATAGCGC