Description :
From Genome Similarity Track
Location :
Scaffold_109:142457- 144505
Transcript NameFunction/comments
Phyci_95988Hypothetical protein

Sequence
2048 bases(100 bases per row)
CTTGAGCTTCCACGTGCGGTAGAAGATGTAGACTTGGCGGATCATGAGGCACACCAGCACCAGCACCTGCAGACCGACGATGGCGAAGGCCACACCTTCG
CGGAGATCGTCCGGGATGCTCTCGGTGAAGCTCGTGGCGCTCGACAGCAGGAAGAAGCTCAGGAAGAGAGCCGAAATCTTGATGATGATGACGAAGCTCG
ACGTCTTCTGCACGAAGGCGGTGGGGTACGGCTGCTTGATCTCTAGGTACAGCAGGAACGCAATGTGGAACGCGATGAGGACGACGATCTGCCACAGACC
CTGGATCCAGACCATGCCCGTCGTCATGCCCGTCAGCAGAGCCAGCAGCAGTTTGGGCGCGAAGAAAAAGCGGCCCTCAAAGCTGTGCTCGTCGTACAGC
GGACCGTAACGCGCGTGGAACTTTTTCTCGAAGTGGTCCTTCGTGCCCAGATCGCGCAGCTCGTCCTCGTTGTTCTTGATGACCAGCACACCGTACAGGA
TCGTACCGAAGGCCAAGCACAGTAGCGTGATAACGGCCAGGAAGAAGCTCAAACCCATTGTGTTGTGGTCGATACAGTAGCAGATCTCGTACATGCCCGT
AGCGCCAACAACGTACTCGGACAGGATCAGAATCATCATGAGCACGCCGATGGCCTTGTCCAGCCACTTCTGACTGAACGTCGGGAAGTCCTCCACCACG
AAGTAGCACACGCCCATAGCAATGGCGTACGCACCGAACAGACAGCCAACCATGCAGGCAATGCCAGCCACAGCCAAGTAAAACAACATGTCGGCCTGAA
CACCAATGAGCGCCGCATACTTCTCCATACCCTGCACGCCCGTCGTCGAAGAAGTTGATCCCGATCCAGAGGTGGAGTTGCTGCTCGCGCTGCCAGTCGT
AAGACGACGCGAATTGGAGCTCTCTTCATCCGACGACGAGTTGGTCTTGCCGAAGGGCAGGAACGTGAAGGCAGCCGGCGCCATCTTCTTGCCCATATTC
TCCATGAAACGCGGACGCGCGTCCACGTTCATCTGGTTCAGCATGATCGAGAACTGGCAAATGTCCACCGCAGCCATGGTGATACCCACACTGGCCGCCG
CCGACACACCCGAAGCCACACCGGCGGAAGTGCCGCCGACAATGCCACTGGCCACCGACATGACACCACCGGCAACAACCGACACAGTAGCAGCGCTGCT
TCCGATCGTCGTCGAGGCGATACCGGCCTTGTCAACCGTCGTCTTCTTCGTGCCGTCCGACCAGTGGTCCGAGTCCTCGAGGCCTTTGTTCACCGGCACC
GAGTACTCCGAGTTGGACGTCGTCGACGTGCCGGACGTACTGGACGACGATGTGGTGGTCGTCGCACCGGCACACTGGCAGGAGCTGAACGAGTTGTCGC
TCTTGTACGCGCACTCGGTGGTGGCAGCAAAAGTCAGGTTCGAGAACGGCTGCTGCACCGCGTCGGCGACGGCCTCCGCCGCCTGCGTGCCGGCGTAGCC
CATGAGAGTGATCAAGTCCAGCCCCGCGTACACCTCCGAGTTGATGCCGTCCTCGGACGAGTAGTCCCACGTGCCGTTGTTGCAGGCCGGGAAGCGGCAC
ACCGACATGCACGTGGCCAGGTCCGAGATCTCCGTGCCCGACGACGTGCCCGAGTAGATCAGACACTCGGTGGACGCCGCCGCCGACGCCACGTCCAGCT
CCGTGCCGTCGCACGTGAGCCCCATCTTGGCCCACGCGCCGTAGAACGTCGAGTCGCAGCTGAACTCGATGGTTGTCGATCCCGACGTGGAGCTGCCGAC
AACGCCCGCAGATCCCGTCATGGACGACGAGCCGgtcgtcgttttcgtggtaggagccgtcgtggccgtggtcgtcgtattgcccttcgtggttcccgtc
gtcttggaagtggacggggtcttggtggtcgacgacggcgtggccgtagttgcagtcggcgccgtggtggccgtcgtggtcgtggtTAGGCCCGTGTCGC
CCGACGACGCTGTCGATACGGCACCCGTCACGCCGGTCGTGGTGTCGG