Description :
From Genome Similarity Track
Location :
Scaffold_2372:1424- 2580
Transcript NameFunction/comments
Pytir_DAOMBR486snap_masked-pir_contig_2372-abinit-gene-0.4HECT ubiquitin ligase
Pytir_DAOMBR486maker-pir_contig_2372-fgenesh-gene-0.0HECT ubiquitin ligase
Pytir_DAOMBR486maker-pir_contig_2372-snap-gene-0.3Gene of unknown function

Sequence
1156 bases(100 bases per row)
TCCATTCACACTAATCTGTCGTGAAGCCGTACAGCTCGAGATCCAGCGTCGCGTACAGAAATCCTCCAACTTGACTCACGACTCGTACAACGGGAGGTCC
AGACGATTGAAGCACGTGTGGCTCACAATGTACTCATTCTCGTTCACACTCATGCCCTTCAGTGTGAACGAACAGAGGTGTCCGTCGTAGCCCGTCAAGG
CACTGAACCCTGCCAACGGAATCTGTGATGAGCCCGTCGTAAAGTGCAGAAGTTGGCGACGGTACTTGTTCGGCATCTCATGAATCGGTTCCCAGAATCA
GGTGAGCACTCGGTGGCCCTTGAGACTGCTGCTGGACTTTGAGTTCACGCGCCAGTCATCCACGTCGATCTCGTCAGATCCACACAGGAGGTAGTCGAAC
TCCTCTGGGTCGAAGAGCATCAGCAGCTCCTGTGGGGTCACCTCGTGCAGTCCTTTCAGGAACACGAACATCTGGCTCAACACGCTCTCATAGACAAGGT
ATCGGAATCTCCGTTCCAGGTACAAATCCTTGTTCTCATCAGTAACGTCAATGTGCCTTCCATCCTTGATCAAGTCGATCGTGACAATCTTGTCGCCCCG
CTTCACTGTGATACTGAAATCCAGACCAAGGGACTCAACACCAGCGTTCTCTTGGACCCACAGCATGCGCTTGAACGCCTCGGGGTCAAAGAACTCCAAG
TCGCTGAAGGTCACGGGCACGCCGAGCATGATCTTGAGCAGCGGTAGTGACAAGTGGAAGCTTAGCGCATAGCCCTCCAACAGCGCTCGTCCGACGAATC
TTCCTGTCGTGTAGTACATGAGGTGGTACTCACCGATATCGCGGCGCGAGTTGGCATTGAAGTAGAACGTTTGCTCCGCCGTGTTGACGCAGCATAGGAT
CCCATTCGACGGGTTGATGATCTCCTGACTGAGGAGCACGAACCACTCGCGGTAGAGCCTGCCAGCATTCACGCCCAGCTTGTCCACGAACGAGATCCGC
ATCACGGACCGAATGTTGTCGCGGCGGATCGTAATCAGGTACTCCATGAGTCGTCCAGTAAGATCATGCGCACAATGCCCACTCAAATCGGCTCCTTGTC
GACGAGCAGCGACACCGTGGTCGCCACGAAATACGCGTACTCGGTGGGGAAATCCT