Description :
From Genome Similarity Track
Location :
scaffold_18:142342- 143753
Transcript NameFunction/comments
g10202.t1hypothetical protein

Sequence
1411 bases(100 bases per row)
CTCCGTGCTGGTGCTCATCCAGCCCTTCCTGATCAAGGCCATCTTGCAGAACCTGGAGGGGCAGGACAACATGTTCGGCATCTCTTCCGGCTACGGCCTG
GCCGTGCTGCTAGGCTGCGTGGCCTTCTGCGGAGCTACAGCCATCAATTCGGCGCAGTTTTTGACTGCGAGAGCAGGCTGCAACGCCCGCATGGTGGTCA
TCAACAGCGTCTTCCAGAAGATCTTGCGTCTGAGCGCGACGGCGAGACGCACGATGAACAGTGGGGAAGTCGTGACGCTCGCTGGAGTGGACAGCGAGCG
CGTCATGGAGGCGTACACGATTGGACTGTGGTGCATTATCTCGCCCATTATCTTGGTGGCCGTGTGCGTTTTGATCGGAACGCAAATGGGCGCGTACGTC
GGGCTGGTGGTGGCGGCCACGAGTGTGGCCATCATGTACGCAGCCTTCACGACCTCCAAGCAGATTGGAGTGTACCGACGACGCATCTCGAAGATCAGCG
CGAACCGCGTCAAGCTGACGAACGAGGTGCTGCTGGGGATCCGAGTGATCAAGTTTTACGCGTGGGAAGACTCGATCAACGAGACGATCCGAGCGATTCG
CGACCAGGAAGTCGCGCTCATGCGGCGCTACAACTATCTGCGCTTGACCAACGCTGTGCTAATGTTTCTGGCGCCCACGATTCTGAACATGGTGTGCTTT
CTCGTGTATATTCTGCTGGGGAACACGCTGGACGTCGCGACGGCGTTTGTGATCCTCGCACTCACAAACGCCTGCAAAATGGCGTTCAGTATTTTTGCAA
ACGCCTCTGTCGCCGTGTCCGAGGCTGTCACTTCAACTGGTCGCTTATCGGACTTCTTGGTAGCTGGCGAGGTGGACGAATCCGCGCACGAACGTACGCT
AGAGCACGACAAGGCCATTATTTCCTTCCAGAACGCAGACTTCCAGTGGGTCGAGGACGCGCCGACTCCGACACTCTCCGATATCACGTTCACTCTACAG
CCTGGAACGCTGACGATTGTTGTTGGCCCGGTCGGGAGTGGCAAGTCCAGCCTCGTGAATGCCATCCTGGGAGAAATGCACCAAATCCGAGGCACAAGAA
GTGTCCAAGGCGACGTGGCGTACGCGAGTCAGCAGGCGTGGATCCAAAACCAAACAGTGCGCGACAACATTTTATTCGGCGAGTCTTACGACGCACATCA
CTACCGGACAGTGGTCACGGCATGCCAGTTGCTGCCTGATTTCGAAATGTTGGAGCAGGGCGATCAAACTGAGATCGGCGAGCGAGGAATTAACCTCAGC
GGCGGACAGAAAGCGCGTGTGGGCATCGCTCGAGCGATGTACCGAGCTCGTAAATTCGACTTCGTTGTGCTCGACGACCCTCTCAGTGCTCTGGATGTCC
ACGTCGCGAAC