Description :
From Genome Similarity Track
Location :
Scaffold_1443:1423- 8589
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1443-snap-gene-0.2Novel transcript
Pytiw_DAOMBR242034snap_masked-piw_contig_1443-abinit-gene-0.4Amino Acid-Polyamine-Organocation (APC) Family

Sequence
7166 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNTCGCGCCCTTCCACCCGAACGAGGTGGTCTTCCGCCAGGGGGACGAAGGGGACGCACTTTACCTCGTCTTCGCCGGCGTC
GTCGAGGTGCGCGTGAGCCAGCGTATCCTGGGCGAGAAGGTCGAGGTGACGGTCTGCGAGCTCTCCAAGGGCGACTACTTTGGCGAGCGCGCGCTGCTGA
GTAACGACATGCGCGCCGCCACGGTGCTCGCCAAGACGGCCACCGAGCTCGTGCGCATCTCGAGTAAGGACTACAACATCATGCTCAAGAAGGACCAGAT
GGAATTCCTCTCGCGCATGCAGATGGCCAACGGCATGGTCATCCCCAAGAGCGTGCAGCAGTCGCAGCGCGAGTACATCAAGGTGCTCACGAAGAAGAAG
AACGCGCGGTCCAAGGCCGACGTCGACATGCTCGGCGAGTACCTCCAGACGCTCAAGTTCTTCCGCGCGCTACCAAAATCCTTTGTGCGTGAGCTCTGCA
CGGTCGTGGACTTTCTTATGCTGCCAGCGGGCACCGCCGTGTTCCGAGAGGGTGAGGTCGGCGAGCTCTTCTACATCGTCTTCACGGGCTCCGTGGACGT
GATCGTGAGCTCGCGGGACTTTCGCGGCAACGCGCAGCAGACCAAGCTCATCAACCTGACAGAAGGATCTCACTTTGGCGAGCTGGCGCTCATGAAGGGC
CACGGCATTCGCTCTGCGACGGTCATGACGCGCGAAGAATGCCGCTTCCTCGTGATTTGCGAGCGCGACTACAACGCCACGCTGCGGCGCATGCAGAAGG
AGGACCTGGCCAAGCGCGTGGGCGTGCTGGACCAAATCCCCATCTTTCAGACGCCCGAGTGGACGGGCGAGCTGCTCAAGGAGATGTCGTACGTGCTCGC
TGAGCAGAAGTTCGCGGCCGGCAGTGAGCTCTTCCGCCAGGGCGACAAGGCGCTCCAGGTCTTCTTCGTCGTACGCGGCGAGCTTGTCGTGGCCAAGGAG
ATCGTGGACCCGGCGGCGGCCCAGGCGACCCACACGGCCTTCGTCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGGGCCGGTACCGCGTCGTGGGCGACGATGCGTACGTGTACCCATCTATGTTGTCATTGCTATGACCTGAC
CACCACTCGTGGACTGATCATCACCCACTAACTTACCATCATTCTATGGCGTTGTTTGCGTGTCAAGTGCGGCCGGAACGACGTTCAATGAAATCATCTT
CCGCGAGGTGACGGTGACCGCAAGCACGCCCGTGGAGGTGCTCGTGCTCTCCAAATACGACGTTTTCCACCGCCTGTCGCGCGCCGCCCGCGAGGCACTA
CGCACGGCCGCGCACTCGCACGCCGAGAGCGTTGTGTACCTCGACCGGTTCCACAAGACGGACAAGTGGAGTCGGTACAAGCAGCGAGTGCTCCAGCAGC
ACGTCAACCACGCGCGGCTCGCCAGGATCCTGCCCCAGACGCCGCGACCGTTAGGCAACGACGCCAGGGCTGTGGTGAAGAGGAGGAAGACGCCTAGAAA
GGTGGAGCCTCAGGCTCCTGGACCAGCCCAAGCAGCGGATACCAGCCAGACAACAGCAAAACTTCAAGACGCGGTGGTGCTCGTGGCCAACAAGAACGCC
CTCGTGGACGCCAATGAGTTTCTGCTGCTCGCGCCGTACGACAACTCTACGCTTGACGCGAGGTCCACGCGCCCGACGATCGGCCACTTTGTATCGACTT
TCAACGCCGACGCCCCGCCGAGTGCCGCAAGGAAGCAGCAGCTGCAGGACGTGCTCGTGGCCGAGCGGCGTCGTCATGTGGCTGTGTTGAATGAAGGCAA
CCCACTGGTGTACTTTGACTTGCAGGAGATCCAGCGGCAGGAGAAGAGGCACCACGCCGAGGCCCGTGGGCGCGCGGCCAGCACGCGACGCACACTGCTA
ACCGGCGGCAGTGCGACCTCAGCTGCCAGTGGCCATGGCATGGGCGCGTCCAGCGTCTTCGACGTGTTTCTCGAGTCACCACTGTCGCTGCCGCCCATGT
CGACAAAGGCAACGCTGGTCGACAAGGTCGCCACAACAGTCATGAACCAGTTTGCACACGAAAACTTTGTATTTTCCCGTCCGACGCGGCCTCAGGACGA
CGACGATGACGCGTTCGCTCACCGGAATCCTCATCGCCACCACCACTATAGACAGCACCATGGCGATGACAGTGAGAGCAAACAGTTGTCAAGCTCACGA
CGGACATCATCGGCACGGAAAGAGCAGCGTTGTGACGGAGACTTTGTGGTCCTGAGCGTCCAGTCCCCCACCAGCAGCCACGAGGCAGCGAACAACAGCA
TCATACGCGCGCTGCAGTCGCCGCTTGTGCAAATTCTCCAGGCGGTGGACTCGCTCGCCCAGGCGCGAGAGATCGCAAGACGAGCGCAAGTCAGGGACGC
TACCAGATTCCAGTCAGGTCACGATTCTGGTGAGGCACTAGACGAGCCACCAGCTGGACTCGCTTACTACCTCGTACCCAAGAAGAAGTACGCGGTAGTG
CCGCGCTCCGAGCTTCAAGATCGCGGCACGGAAGAGAGACTGCAGCGTGAACTGTACGAGCGATTCGCGCGCTCGTCCGTCCTTCCAGTCTCTGCCGGCG
CTATTGCAGGCCACAGTGGCCACGGAAGGCGGCCAAGCATGGCTGTACTCTACAGCTCAGGCGCGTACCCTGAGCGACTGAGCTCCACTGCACCTGTCGC
GTCAGCAACCACCTCGCTAGCAGTAGGCTCATCAGTCGAGACCTCGGAACTCTTTGCCTCATTCCAGAAAATCGAGTTCTCTGCAGTCGAGCAGCGCGAG
ATCGCTGCCAGTGCACAGCCACCAGACTCGTCGGCTCCTGGAAGCGAGGCCAACAGCTCGTCCAGTGCCGCTGAACCAGGAGCTCTGGGCTCAAGTCCAC
CCAGCCCACGCCCACGGCTGTTTGCAATCGTGAGCGTGATCCTCTCTCGACACGAAATCGAGAACGCGGCGGGCGACGAGCCGTTCCTGTGTGTGCACCA
GCTCTTCACGTCCGAGATGCAGGCCATGGACGCGGCGCTGGCCATGACGCCGCAGCACTTTCGCAACGCGCTGCTCTGCGTCCTACCCATGGACGAGCCC
GTGCACCTCGAGGACGCATACGACCACTGCGTCCAAGTGGAGAGCGACCGGCGCGAGAAGCGCGCGTCCGGTGTCTCACTCTCACCCAAGCGCAACAGCA
GAACCGCCACTGGCAAGGCGTCTCAGCCACAGTCGCACCACCGCGTGTCTGGGGTGACCAGCAGAAGCTCGGGGCCTCGCAGTCCGAACTCCACAGCCAA
GCCCAGCATCATCGCAGCGACCACTGAGTGGCAGGTCGAGCGAGACAAGGCGCATCGCCTACACCAGTTCATCTGCTCGCGTCTGGGCCAGAAGGCCACG
CTCGACAAGGAGCGCCGTGAGCAGCAAGAGTTCACGGGCTTCACACCCAAGCCGCTGCTCACGCTCGACGAGAAGCTCACAACGCTGCACGAGTACCTCG
AGAGCTCAAACGCTGCGGCCGTGAGCGCGCGAGGCGGCGGAGGTGCGCACGCGCTGGGTAAGTACCGCCAGATGAAGCGCTTCGGCTCGATCATGAAGGC
GCGCCTGAGCTCGACGCTCGCCAGCAGCAGCACAGTTGGTACTCCAGTGAGTCCAGGAGCCACGGCTCAACCAGCATCTCCACTGGTGGTGCCTGGCGCT
GCTAGCTAGCTATGTGAGCTCTTGAGCGAAATGTTTACTTTAACGAGAGATGGCAACCTTCAAGTTCTAAATTAATTGGTGTAGATGTGGTTGCCCTTTC
TGCTCTCGGCGGGCGTCAAGCGTCCTTCTTCGGCGGACAACATGGGCGCGTTGAGTCCGGGCGTGAGGAGTAGCTTGCTGTGCGTGAGCAGCATGCTCCA
GCCGCTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGACCCACGCGCAACTGAGCGCCAGGCCGCGGTGGCTTAGCTGCGCGATCATGTACCAGTCGG
CAAGGATCGAGATCGCGGGGATGAAGGGCACGAGCGGCGCTGCGAAGTAGAGCGTCTGGTCGGTCTGCTGCGGGCACTTGGCGTAGTAGTAGACCGTGAC
GCCCACTGATGCCACGAGGCAAATGATCGCGAGCACGAGGCATGCGTCCGAGCCCTGGTTCACAGATCCCTGCTGGTACAGAAAGGCCGCGAGCCCCGTG
AGCACCACGAGCGCGCCGATGAGCTGGCCGCCGAGCACGGGCGACGCCTCGCGCGTGCGGATGTTGAGCAGCGCGATGTTGGCCAGGATGAAGGACATCA
TGACGCCAAAGTTGACGATGTCCCAGAGCGTGTCGAAGGGCAGCACAATGGCCACGACCGTAAGGAAGAGACCAGAGATGAGGATGTTCCAGAAAAGGTT
TTTGCGACTATCCACCTGCGCGAAGATCTTGGGGATAAGCCCGTCGCAAGCGAGCGCGTAGTTGACGCGCGGCTGCGCAAGGAAGCCCACGAGCACGACC
ACGGGCATGGTCACGACCTCGCCGGCACGCACGATCGTGCCGGCCCACTTCCAGCCGTGGTACTCGAAGCCGTCGGCGAAGCTGCCGGCGTCCAGGTACG
GGATCATGCCGGCGAGCACGAAGGAGCAGAGCGCGCTGATAAGCACTGTGGCGACCACGACGATCATGACGGCGATGGGCACGTTGCGCTTGGCGTTGCG
CGCCTCGCCCGAGAGGCAGCAGACCTCGTCGAAGCCCGAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCCTGGAAGCCAAAGGCATTGTTCACGGCGCCACCGCT
CGTAGTCAGTGAGGTGCGCGGCGGGATGAAGGGCGACAGGTTGGCCGTGTCAAGCGCCGCGAGACCCGCGATGGCGATGAACGCGACCACTGAGACCTTG
AGGATTGTGAAGGTGTTGACGAAGTTTTTGCTGAAGCGCACGCCCATGAGAAGCACGACCATGCTGAGGAACTGGATGAGCCCACCGAGCAGATTGGCGT
GCTTGAGGTTGAGCCAGTCGAAGCTGCTGTGCGGGTGCTCGAGCACGAGCCACTCCTGGACCTTGTCGGCCCAGCTGCGCGCGACGCCGGCCGCCGAGAT
GGAGTACTCGAGCGACACGAGCCAGGCCGCGACGACGGCCGGCAGCTCGCCGATGCCGTGGTACGAGTAGGCGTACGTGCTGCCGCCCGAAGGGATGCGC
GTGCTCAGCTCCATGTACGCGAACGTGTTGAAGACACAGACGACGCCGCCGAAGAGCCAGCTAAGCACGGCAGCCGGGCCGGCGATGGTCGAGATCATGA
GGCCCGTGGTCGAGAAGACGCCCGAGCCGATCGTGGCGCCCATGCCAAGGCAGATGAGGTCAAACATGCCGAGCGTGCGCTCGAGGTCCTCCTTCTTCTC
CTCGGCGTCGATCACGTGCAGCGGCTTGGTGCGGAACATGCTGTCTAGCAGCGACGGCGAGGCTGAGCCTGAGGCTGAGACTGGGTGCTGGACGTCTGCC
ATGGCAACTGGCTGGGTCCCGTAGAGCGCCTGGAGCTGGATACTTCCGCTGAGAGGCGAATTGAAGAGTGCTGTCTGGGTCTGAGTCGTGGCCATGGCGA
GAGCGGATTGCGCTTTCTTGTGGCTGTTGGGCACCGTCCTGGGGATCTTGCGCGGTTGTCCCAGGCCAACCACAGCTCCAAGCGGCCGTGACAGGCGGAG
GAACGTGCTCATCAGCTCATAGGCCTGGGCCGTCTGCTGCAGGTGATTGATCAATCACATGTGCGTACTTTAGCGAGAGAAAGGCGCATGTATGCATGAG
ATTCGTATTTAAAGAATACTATATGAAAGATAGACCAGAACTCACTGTCAAGAAAGTGCTGACTTTATAATGCGCGGATATAGTATGTAATTGTTTTGGG
AAAGCCAGTCGGATGGCAGTCAGCGAAAGCAAATCCAGGTGGAAAACGAGTGGAGCTCCTGGACTCATCACACGAGCTCCGAGTGCGTCGGAGAAGGCGC
GATCGCGGATTGGCTCGGAGCTGTTGTCGGATACCTCACAGGGTACCTCAGATCTGTCTGCTGGAGCCTCGTGTCTTTCTGGCTGGGGCTCGTCGTGTCT
TTCTGGCTGGGGCTCGTCGTCTCTTCTCGTCTGACGACTCGTGAGTGACGAGGCATCGACCTGGCGAGGAGCTCTCTGACGACCACCTTCGCTTGGACAA
GAGCGGCGGGATATCCCATCCCAGCCCATTGCCTGGTCCACGCCTGAGTGGGCCCACGTCAGGAAAGATCGTCACCTTGTTCAAACGTCGTCGGTCTCTT
CGAGTTCGCTTCGACACGCTGATCTCGTCTTCGCTGCGTGCAGCCATCATCTTTAGTTGGGTCCCAGACGTAGTCTCGTCGACCGGTGACTGCTCTCGCT
TGCATTCGATCTCCGAAGGAGCTCTCAGATCACCAACTTCACTTAGAGACTTGAGAGCAGCGAGTTGTCCCATCTAAGCTCAACCAACGAGGTCCACGCG
TCCAGAATGGGCTCTCGTCATGACAGATCGATCCCCACGGGGTTTATAGGTAAGTACACTCAGCTC