Description :
From Genome Similarity Track
Location :
Scaffold_162:142278- 146717
Transcript NameFunction/comments
Hyaar_Emoy2811583secreted RxLR effector peptide protein, putative

Sequence
4439 bases(100 bases per row)
TGCATTGATCACTTCCGGACCTTGGGTCACAATATGGTCGATTTTGTTCGACCCCAATTAACACTCTAGGCTTGTCAAGCGTGAGGTGTTGGGCCTCACA
GAGATAAGCTAGACTTTTTATCTCAACAGATGATTAGTCGATTTGCGACTACGGTGTAGGATTGACAAAAAGTGATACCAAGTGTAGTGGAGCTACACGG
CTCTTAGTCAGAGGAAGCCTTACGACTCTAGAAGTCACTTAGTTCTACGGAACTAAGTTCCTATTAGTTTAAAGATCTTTAGTTCTTAGAACAAATCAAC
AAAGACTTGAAGAGTCTTCAAGCTCGTAGAGCTTCTAGTCCTGGTTCAAGGGACTAATAACGACTCTAAGTATTGTATGCACAATGTGCTCTAGAGTACG
CCACAAGCTGGCTCTTACTCTTAACGATCTACTGACGTCTAAACTAGACACGTGTCACTCGAAGATTAATAGGGGAACTGAACTTTTATTTCTTAGTTTT
ATCTGTAATAAACCTCATTCAACTACTAATACTAAGGTTAAACTAACTCGCGTAGTAATCTTCAGTCTACTAAAGATTGATGGATGGTACATCAATCTGT
CATCAATGGATGGTACATCAATCTGTCATCAATGGATGACTGAGTTTATCAACCACATCAATTATCACAGAAAAACTCGGGATTGTATATCACATATACA
AGGTATATCCCTTTAGGGCGGTAACTGTCGTGTGACCCCGTTACAACGGTTCATTGTACGAGGTTGACTGAAGCTTGGTGTTGAGGTGAGCGTTCACGCC
CAAAATGGCGTAAAAACGACATATTTCTCACACTACCGGTTCTACAAACCGTCTTATGACCCCGTTACATTGCTGTAGTAAGTAGGAGCAGGAGTTCAAC
TCTCGTCTATTTACATATTAATATGTACAAGATGTCTAAAAGTTCTGAGTCAGTATTGAGCGCTGATGGGCAATATATTGTGGCTTACAGCCGTGGATGC
CATTGCCCTGATGTACCACAAATTAATATCTCAAGACACGCGTGAAGTCAGAACCCACTTCATGCTATTGCTGTAGGCGATGTCCATGTATTGATACAGC
CTACAACTGAGAGAGGTCGATTTCAAAGTACTTTGAGACGCTCGTAGATGGAGATGTTCGTTTGACTCAAGCCACTGCATTTTTCGGCCCACCTATGTAC
TTGACATATGAACCTGTAATAAAAGTCGATGCGTTTGAATTATAATCCGGCTGCCATGGCGCCGTTGTGAAACCTTTTTGCGGTCGCAGAAGTAGACGTA
TAGGCATTGGTGAATCTTCTACATTGGCGCAGTGATCTAATTCCTTGTATATGACCTGGGACAACCCTTCTATCTCGCCAAATAAGCGGCTATTAAATTG
ACTTCAGTACGCTTAAATTTGGCACCCCAAGAATGTGCGCGGTAGTATCCTTTTATAATGGGAGCCGCTAGTGAGCCTTCACATTTTGCTAATGAGTCTT
CACCCCATACATAAATGAAGTATTAAATTTGAAACCCCCTAAATTGTCAAGTTGCTTGATTTACTTTATGCTTCTAATTTTTTAATCTTCACAGTCGAGA
CTGAGCCAGTCATATCCGCAGCTAACATATATCAGCCTCTCCGACAGGTGAGAGCACTAAAAATATAGGCTTGCACCGGATTATATAAGGTGAATACCAT
CCCGCCCTACACCACGTCTCTCAAACCATTGAGAGGACCACCCCGAAAAGCTCCAACGACGGCACTTCGTTTATACTACAAACGTTTATTCAGACCATCT
CCACATTAACATGTAGACATACGAGCGAGTAAACACAATACATATGTTGTATTCTGCTCACCCTCTAGGTATGCTTGAGTGCTATTATATATCTTCTTCA
TGAATCGCCTGTTGTGGACAGCGTTGCATGAGCATTGCAGATTCACTGCTTTAACCTCAATTTCCTTGATGTTTTTCACCCTTTTTGTTGCCGTTTAATT
GTTGTATGATAGCCTTCCGGCAGTGTCAGCTCGTCAAGCGCGTGACAAGCGTCGTCAACAGAAAAATAGCTCTTCTGTGATCTGGTTAATGCCTTCCATG
TTTCTTCAAAAAAGGAAGTTAGAAGTACGATAGCGTAGGTGATATGAGATGGAATGGACATTATTTCTGAAATGTACAACAAAACAAATCGACAATCTAG
GCGGTTTCAAATTCGATTACTTGTTTCATGTATGAGGTGAAGGCTAATCAGCGAAAGTGAAGGCTCACTAGCGGCTCCCTTTATAATTCACGATTCTTTA
TTACTAACGCCAATCATTGGGTCGCCTAAAATAGGTTTTGCTGATTGGTCGCGATGCGAAAATCGTGCATATTGTAGGAAATTGTTAGATTCACTCCCTT
TTTGGTTAAATTCACTTCCTTTTCTTTCATTTAGTAAACATTTTAAACAGCCAATTCTGATTGGTCAATATACGTATAAAAGCTTCTCGTTTAGCATATC
ATATAATACGGTTCCATCCTACTTAAACGAGAAGTCACGTTAGTGCACACACCTCAAGATCGTACCTAGTATGACATTCGTCCGCAAATTTCTCATATCT
GGCTCTTACTCTACGACCTATTCGGTCAGTACAATTGATACATTCTGCACTCGCGGTATTCGTGACACAAAATTAGCCATCGGTTTAAAACGGCATTTTC
TAAACTTGTTAAGAGTAGGGTAGATGCCACAGTGGCTCTCAATTTCTGCGGAGTTTTGACGATGGCATAACTATTTAGAAATTACAATATATGGCTGAAT
TACGAGCGGAAGTCATTTTCACGCAAACGCGCATTTTATCGTTTTAGACACTTGAATGTGTCGATAAGAAGAAGAATAGCAAAGTACAGTATCGCGTGGT
GTTTTTATGATAATAGCGAATCATAATGATAGCCACACGTTACTACACTTTGTGATGATTCTATACGGCCTCATTTCCTTTTTCGTGTGACATCTATATC
GCTGGTTCTGCTGATCTGTAAATGTGCATAATTGCCCTTCATCGTCCTCATCACCACCATCCCTGTCTTTTTCGTCTTCTGCTTTTCCCTTATTCCATTC
AATTTTTTTTCTTATATACATTATTATCCTTGTCCGTTGAATACCATTCAAAGCAGTGCGTGACCGTATTGTCGATTGTGAATATCGATAGGAGTGTTTG
CTCTTAAAGGTGCAGTATTGTGGCCTTGAAGTACTTTCTATGGAGAAGTTAGTAGAAATAGTATGCTATCACTAGACGTATACGCATTTCTTATCCATAT
ACTTATGATTACAGGCTAATAGTGCACGCAAGAGCATTGCCGCCATCTTATCCCCCATGGCATCGCCCTGTCTTAAGGTAATGACAATTGGTGGGACCGC
TAGGCCACCGGACGACGCCATATAGTCATAACAATAATTCGGCTTGCAAGGGCATAAAGGAGAAAATAAGTATACTTAGCAGCTAAATGTTAACCAATGT
AAACATTTAGCGACATGCGTTTACTTAACTGAAGAAATAGGGAGTGAATCTAACTAAAAAGGGAGTGAATCTAACAATTTCTATTTTATGGACAAGCAGA
CTGTGCAACAGCGACGTTCAGTTGAGCGACGACCCCTCCCCTAAGCAATTCAATCTGTTTATATCAATCATCCCTTTTTAGCCAATAAACTATTGGCTTT
TTCCAATAAAAGCAAGACTCTGACCCGACCAGTGTCTACAGTGTCCGAACCGATAACAACAATAGCTGGGCTAACAGCCTTCTGCGCTTTGCTTCCGCTA
CTCATGATCCGAAGCACAATGCGCTTTCCTATCGTGCTCCTCTGTGGCGTACTCGTGCTGACTGCCACCATGAATGCTGAATTTCACTCGCACTTGGTCG
AGTTTGACGTGTTGGCGTCGAATAATATCACTTCGGAGCATCAGGGCGAAGCGCAGTCGGGTCAAAACCCAAAGAATGGCGATTTTGTGAACAGGAACTA
CAACGAGGAGAGGGTCTCCGCATGGAAAGTAATACAAGGTATCGCGAATTTCGAGAAAATAATTCAGTGGCGAGATCTCCGAAGAGCACAGGATGGCTTG
CTTCATCATGAGATGTCATCGGACTACGTGTTCAAAAGGCTAGGTCTCGACAAAGCCAATAAGCAGCTTTTTGACGATCCGAAGTTTAGCGTTTGGGCTG
ATCACATATTGTACACGTCAAGCGCCTTGGAATCCAACCCCGGGGTGGTAATGCTGTCTACACTAAAGAACCATTACCTGGAAGACCAGCTGTTGGACCT
GCTCATATCAGCAGAGAAGACCAATGCGATCGAGTTTATTTTTTCTGAAGTGCAAGCCGAATGGTTGATTTTTGAGAGAGATGTGAAATACGTGTTCTTA
AGGTAGATGATTTGGAGAACAACTTTTCGAGGCACGCGG