Description :
From Genome Similarity Track
Location :
Scaffold_51:142273- 143700
Sequence
1427 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GATGGAAGATTCTACAACCAGATCCGCCAATGGTCTTGTATCCAGCCAAGCGCCGAGGGATGTTGCCAGAAGTGGCCCATAAGATGTTAAACTAGGACGC
TCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCTTTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATC
CAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCCCCAAGTGGATGAGTTTTCCAGATCCGAAGTCTCTTCAACCCT
GGATCTACAAAGGGGAGAGGCACGTGGTTATTGGGAGAAGCGCCAACATGGCCGATGGTTTGAGCCTACCGAGGGTGAGGTCACTGCAGATCCACCTAAG
GTCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCGTGGATCTGCTAACCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCTCAGGAA
AGTGGTTCAGACAAGCCAATGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGGTGTCTATACTAGATACCGCCT
TTGCTCGTAAGGTTGGGTGCCCAAGTGGATGGGAGTCGGATCCAATATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAATGGGAGACCGCGGATCA
AGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATCTGGGTTGGAGATCTCGCTGGTCAAGACACCATCCTCGGGATGGATTTCATGGTACCGGC
CGGAGTGAGGTTGGATCTAGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTATGGAGCAAAGATGAGG
ATCATAAGGGCGGATAAGACGACCTGGATCGAGCCCGGGGAAACCTGGGAGCTGCCAGACCAATTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACTC
GGGGCGAGAAATGGGTACCTACCGTAATCCAGGGGCCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGATAAGAGACTATTACTGGACCATTA
TGAGGAGATCGGGCGATGGGTAGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATTTCGCCGCTACAAAGAATGGCAGAATCTGGCG
TACGAGGCGACAACTGAGATCGAGTCTCTCGGAGAGGTGGAGCTCCCGGCGGGGCCAGCTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAA
AGATCCTGCAGAGAAGGCGTCGGATCG